G251351


Basic Information

Item Value
gene id G251351
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000059
NCBI id null
chromosome length 10376574
location 119724 ~ 120008 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU285315
ACCAACAATCTTCAGAATATCTTCTTTTGTGTTTTTCTTTTGTGTGTAAATGACAGAATTTTCATTTTTGGGTGAACTATCCCTTATGATATCATTATGATATATTAGTTGTTTGACCTGTGATTGAGGTGTTATTTGTAGGTCAACAAGTGTTGTGCTGACTTAATAAATTGCAGAAGTCAAAATGGCAAAACTGTCCCAGATTACCTTAATTCACCCACACAATGTGCTTCAAACCAGGAACTATTCAGTGATGTATTCAGGCATCTTAAATTTTGACAAGAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU285315 True 285 lncRNA 0.33 1 119724 120008

Neighbor

gene id symbol gene type direction distance location
CI01000059_00101987_00103012 NA coding downstream 16712 100962 ~ 103012 (-)
CI01000059_00075079_00094725 CLDN15B coding downstream 24999 75079 ~ 94725 (-)
CI01000059_00056355_00058350 NA coding downstream 61037 55972 ~ 58687 (-)
CI01000059_00013963_00014292 NA coding downstream 105379 13775 ~ 14345 (-)
CI01000059_00001701_00003260 NA coding downstream 115413 1695 ~ 4311 (-)
CI01000059_00130626_00143117 ARHGEF15 coding upstream 10198 130206 ~ 143117 (-)
CI01000059_00144949_00157845 GRK1B, GRK1 coding upstream 24325 144333 ~ 157885 (-)
CI01000059_00185897_00188899 SLC25A35 coding upstream 65829 185837 ~ 189044 (-)
CI01000059_00190249_00194415 NA coding upstream 70102 190110 ~ 194464 (-)
CI01000059_00196450_00199898 NA coding upstream 76257 196265 ~ 199898 (-)
G251314 NA non-coding downstream 20575 95696 ~ 99149 (-)
G251335 NA non-coding upstream 29913 149921 ~ 150157 (-)
G251359 NA non-coding upstream 115379 235387 ~ 240320 (-)
G251360 NA non-coding upstream 123324 243332 ~ 243677 (-)
G251362 NA non-coding upstream 124434 244442 ~ 244659 (-)
G251365 NA non-coding upstream 130972 250980 ~ 255004 (-)
CI01000059_00378673_00379901 NA other upstream 249923 378587 ~ 380137 (-)
CI01000059_01253451_01254823 NA other upstream 1131708 1251716 ~ 1254823 (-)
CI01000059_02096875_02098872 CDC26 other upstream 1976689 2094279 ~ 2098985 (-)
G253013 NA other upstream 3351467 3471475 ~ 3471909 (-)
G253914 NA other upstream 4633530 4753538 ~ 4754082 (-)

Expression


Co-expression Network