G251365


Basic Information

Item Value
gene id G251365
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000059
NCBI id null
chromosome length 10376574
location 250980 ~ 255004 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU285331
GGATAATCCAACCCAGAAAACAGGGCACACGACGAAAGTCCAGAAACCAAAAACCAGGAAGAAACACACAGAGAACACGACACCGGGAACAGCCTGCAACGAACTGACAAAGACCACATAAAGACATGCACAATATATAACAACCACTAACAAGACACGGCTGGCAACAGATCGCAATCAGACCATAATGGGTGACGCCCACACAATCATTCACTCACACCCAACACACACACATACACAAACACAACAACACACGAGGGTGAGTAAGTGAATCCATGAACCGTGACAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU285331 True 289 lncRNA 0.47 2 250980 255004

Neighbor

gene id symbol gene type direction distance location
CI01000059_00213992_00224796 ZMYND19 coding downstream 26184 212582 ~ 224796 (-)
CI01000059_00196450_00199898 NA coding downstream 51082 196265 ~ 199898 (-)
CI01000059_00190249_00194415 NA coding downstream 56516 190110 ~ 194464 (-)
CI01000059_00185897_00188899 SLC25A35 coding downstream 61936 185837 ~ 189044 (-)
CI01000059_00144949_00157845 GRK1B, GRK1 coding downstream 93095 144333 ~ 157885 (-)
CI01000059_00274535_00278600 COQ4 coding upstream 19383 274387 ~ 278600 (-)
CI01000059_00311235_00321078 FBXW5 coding upstream 56042 311046 ~ 321078 (-)
CI01000059_00326063_00336542 HEM2, ALAD coding upstream 71033 326037 ~ 336542 (-)
CI01000059_00378673_00379901 NA coding upstream 123669 378587 ~ 380137 (-)
CI01000059_00456370_00458895 NA coding upstream 201280 456284 ~ 459440 (-)
G251362 NA non-coding downstream 6321 244442 ~ 244659 (-)
G251360 NA non-coding downstream 7303 243332 ~ 243677 (-)
G251359 NA non-coding downstream 10660 235387 ~ 240320 (-)
G251335 NA non-coding downstream 100823 149921 ~ 150157 (-)
G251351 NA non-coding downstream 130972 119724 ~ 120008 (-)
G251371 NA non-coding upstream 9848 264852 ~ 265068 (-)
G251372 NA non-coding upstream 11098 266102 ~ 266603 (-)
G251373 NA non-coding upstream 12697 267701 ~ 268106 (-)
G251334 NA non-coding upstream 29275 284279 ~ 286749 (-)
G251332 NA non-coding upstream 33433 288437 ~ 289053 (-)
CI01000059_01253451_01254823 NA other upstream 996712 1251716 ~ 1254823 (-)
CI01000059_02096875_02098872 CDC26 other upstream 1841693 2094279 ~ 2098985 (-)
G253013 NA other upstream 3216471 3471475 ~ 3471909 (-)
G253914 NA other upstream 4498534 4753538 ~ 4754082 (-)

Expression


Co-expression Network