G251469



Basic Information


Item Value
gene id G251469
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000059
NCBI id null
chromosome length 10376574
location 545455 ~ 545706 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU285449
AGCGTCCTGAGTCCACATCAGCGTTGCCCTGGAAACTCACGAGGAGCACCTGCTCACAGGTCGTCACAGGCTGATCGGCCACACCTGCGGCTGATCAACCTGCCTGCATATAAGCAGCATGCTCACAGACAAAGGTGGAGAAGCCTCTCCATGAGACAGCAGACTAACGTTCTCTCTCTATCCCGTTCCAGAAAGCAGTGTGTGACCGATCAGCACCGCCACGAGCACCGCACGGATTCACCCACACCTGGA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU285449 True 252 lncRNA 0.57 1 545455 545706

Neighbor


gene id symbol gene type direction distance location
CI01000059_00513674_00528840 SLC30A5, CCNB1 coding downstream 15506 513469 ~ 529949 (-)
CI01000059_00476366_00482307 NA coding downstream 63148 475994 ~ 482307 (-)
CI01000059_00456370_00458895 NA coding downstream 86015 456284 ~ 459440 (-)
CI01000059_00378673_00379901 NA coding downstream 165431 378587 ~ 380137 (-)
CI01000059_00326063_00336542 HEM2, ALAD coding downstream 208913 326037 ~ 336542 (-)
CI01000059_00570850_00600462 DKFZP459B1536, PIK3R1 coding upstream 25144 570850 ~ 600858 (-)
CI01000059_00697568_00720771 MAST4 coding upstream 151862 697568 ~ 720771 (-)
CI01000059_00767393_00826328 NA coding upstream 220027 765733 ~ 826581 (-)
CI01000059_00853242_00855219 NA coding upstream 307048 852754 ~ 855284 (-)
CI01000059_00867492_00873239 NA coding upstream 320959 866665 ~ 873239 (-)
G251407 NA non-coding downstream 111985 432911 ~ 433470 (-)
G251421 NA non-coding downstream 133830 406179 ~ 411625 (-)
G251420 NA non-coding downstream 134842 405725 ~ 410613 (-)
G251375 NA non-coding downstream 214159 330999 ~ 331296 (-)
G251315 NA non-coding downstream 238986 301527 ~ 306469 (-)
G251478 NA non-coding upstream 13921 559627 ~ 559991 (-)
G251393 NA non-coding upstream 41224 586930 ~ 594125 (-)
G251484 NA non-coding upstream 66457 612163 ~ 612566 (-)
G251518 NA non-coding upstream 84272 629978 ~ 630230 (-)
G251528 NA non-coding upstream 110926 656632 ~ 656864 (-)
CI01000059_01253451_01254823 NA other upstream 706010 1251716 ~ 1254823 (-)
CI01000059_02096875_02098872 CDC26 other upstream 1550991 2094279 ~ 2098985 (-)
G253013 NA other upstream 2925769 3471475 ~ 3471909 (-)
G253914 NA other upstream 4207832 4753538 ~ 4754082 (-)
G254203 NA other upstream 4692080 5237786 ~ 5238299 (-)

Expression



Co-expression Network