G251529



Basic Information


Item Value
gene id G251529
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000059
NCBI id null
chromosome length 10376574
location 660013 ~ 660240 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU285527
AGCAATACAACGCCATTGCCATAGAAACCAATGCAGATATTCCAGAAAACGAAAGAGCAGCATGGACACACAAATCAGATCTGAACAGTTGCGAAACACAATGTGGACAGTCAATAATTTTAGATCAGATTCCAATCGGATACACAAATAATCAGATTTGGGTTGACAGTGTGAACATAGCCATAGAGACAAAGTTTTAGCCTCATTCTACTTGGGCCAATAAGCAAC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU285527 True 228 lncRNA 0.39 1 660013 660240

Neighbor


gene id symbol gene type direction distance location
CI01000059_00570850_00600462 DKFZP459B1536, PIK3R1 coding downstream 59155 570850 ~ 600858 (-)
CI01000059_00513674_00528840 SLC30A5, CCNB1 coding downstream 130064 513469 ~ 529949 (-)
CI01000059_00476366_00482307 NA coding downstream 177706 475994 ~ 482307 (-)
CI01000059_00456370_00458895 NA coding downstream 200573 456284 ~ 459440 (-)
CI01000059_00378673_00379901 NA coding downstream 279989 378587 ~ 380137 (-)
CI01000059_00697568_00720771 MAST4 coding upstream 37328 697568 ~ 720771 (-)
CI01000059_00767393_00826328 NA coding upstream 105493 765733 ~ 826581 (-)
CI01000059_00853242_00855219 NA coding upstream 192514 852754 ~ 855284 (-)
CI01000059_00867492_00873239 NA coding upstream 206425 866665 ~ 873239 (-)
CI01000059_00991306_01000173 BMCC1, PRUNE2 coding upstream 330791 991031 ~ 1000173 (-)
G251528 NA non-coding downstream 3149 656632 ~ 656864 (-)
G251518 NA non-coding downstream 29783 629978 ~ 630230 (-)
G251484 NA non-coding downstream 47447 612163 ~ 612566 (-)
G251393 NA non-coding downstream 65888 586930 ~ 594125 (-)
G251478 NA non-coding downstream 100022 559627 ~ 559991 (-)
G251534 NA non-coding upstream 8983 669223 ~ 670067 (-)
G251537 NA non-coding upstream 13968 674208 ~ 674444 (-)
G251540 NA non-coding upstream 17275 677515 ~ 677758 (-)
G251549 NA non-coding upstream 22500 682740 ~ 683017 (-)
G251569 NA non-coding upstream 226427 886667 ~ 886876 (-)
CI01000059_01253451_01254823 NA other upstream 591476 1251716 ~ 1254823 (-)
CI01000059_02096875_02098872 CDC26 other upstream 1436457 2094279 ~ 2098985 (-)
G253013 NA other upstream 2811235 3471475 ~ 3471909 (-)
G253914 NA other upstream 4093298 4753538 ~ 4754082 (-)
G254203 NA other upstream 4577546 5237786 ~ 5238299 (-)

Expression



Co-expression Network