G255108


Basic Information

Item Value
gene id G255108
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000059
NCBI id null
chromosome length 10376574
location 6407749 ~ 6407990 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU289529
CCAACTTTATGGAGATGCAGATTTCATTTTCCAACAGGACTTGGCACCTGCACACAGTGCCAAAGCTACCAGTACCTGGTTTAAGGACCATGGTATCCCTGTTCTTAATTGGCCAGCAAACTCGCCTGACCTTAACCCCATAGAAAATCTATGGGGTACTGTGAAGAGGAAGATCCGATATGCCAGACCCAACAATGCAGAAGAGCTGAAGGCAACTATCAGAGCAACCTGGGCTCTTATAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU289529 True 242 lncRNA 0.47 1 6407749 6407990

Neighbor

gene id symbol gene type direction distance location
CI01000059_06368210_06388793 ARHGAP31 coding downstream 18546 6367217 ~ 6389203 (-)
CI01000059_06294175_06303446 ZBTB20 coding downstream 104303 6293981 ~ 6303446 (-)
CI01000059_06266617_06275670 NA coding downstream 132079 6266617 ~ 6275670 (-)
CI01000059_06248905_06250044 NA coding downstream 157327 6248905 ~ 6250422 (-)
CI01000059_06170785_06173405 NA coding downstream 234210 6170785 ~ 6173539 (-)
CI01000059_06413479_06420106 B4GALT4 coding upstream 5489 6413479 ~ 6420106 (-)
CI01000059_06430220_06439547 CASR coding upstream 21894 6429884 ~ 6439547 (-)
CI01000059_06446066_06457895 EIF4E1B coding upstream 37286 6445276 ~ 6457919 (-)
CI01000059_06521399_06533677 TAGLN3A, TAGLN3 coding upstream 113169 6521159 ~ 6534556 (-)
CI01000059_06537186_06537567 NA coding upstream 129114 6537104 ~ 6539310 (-)
G255106 NA non-coding downstream 3786 6403735 ~ 6403963 (-)
G255103 NA non-coding downstream 7135 6399892 ~ 6400614 (-)
G255100 NA non-coding downstream 43537 6363998 ~ 6364212 (-)
G255099 NA non-coding downstream 43801 6363723 ~ 6363948 (-)
G255086 NA non-coding downstream 182121 6225335 ~ 6225628 (-)
G255117 NA non-coding upstream 59194 6467184 ~ 6467444 (-)
G255118 NA non-coding upstream 62670 6470660 ~ 6470873 (-)
G255134 NA non-coding upstream 127228 6535218 ~ 6535596 (-)
G255168 NA non-coding upstream 161881 6569871 ~ 6570111 (-)
G255172 NA non-coding upstream 166441 6574431 ~ 6574642 (-)
G255092 NA other downstream 164957 6236106 ~ 6242792 (-)
G254203 NA other downstream 1169450 5237786 ~ 5238299 (-)
G253914 NA other downstream 1653667 4753538 ~ 4754082 (-)
G253013 NA other downstream 2935840 3471475 ~ 3471909 (-)
CI01000059_02096875_02098872 CDC26 other downstream 4308082 2094279 ~ 2098985 (-)
G256890 NA other upstream 2573706 8981696 ~ 8982117 (-)
G257014 NA other upstream 3046226 9454216 ~ 9599008 (-)

Expression


Co-expression Network