G255238



Basic Information


Item Value
gene id G255238
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000059
NCBI id null
chromosome length 10376574
location 6810802 ~ 6811025 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU289686
CTTGGCCAGATCTGTGCCTTCCACAATTCTGTCTCTGAGCTCTTCAGGCAGTTCCTTTGACCTCATGATTCTCATTTGCTCTGACATGCACTGTGAGCTGTAAATTCTTATATAGACAGGTGTGTGGCTTTCCTAATCAAGTCCAATCAGTATAATCAAACACGGCTGGACTCAAATGAAGGTGTAGAACCATCTCAAGGATGATCAGAAGAAATGGACAGCAT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU289686 True 224 lncRNA 0.43 1 6810802 6811025

Neighbor


gene id symbol gene type direction distance location
CI01000059_06743553_06768560 KIF1C coding downstream 42242 6743261 ~ 6768560 (-)
CI01000059_06668658_06675615 SLC25A11 coding downstream 135187 6666920 ~ 6675615 (-)
CI01000059_06656629_06660298 SPAG7 coding downstream 150504 6656387 ~ 6660298 (-)
CI01000059_06642665_06650346 RNF167 coding downstream 159804 6642309 ~ 6650998 (-)
CI01000059_06621058_06632392 WASF3 coding downstream 177893 6619898 ~ 6632909 (-)
CI01000059_06817935_06848280 NA coding upstream 6865 6817890 ~ 6848280 (-)
CI01000059_06914640_06936857 NA coding upstream 102837 6913862 ~ 6936857 (-)
CI01000059_07002729_07060398 DLG4 coding upstream 191652 7002677 ~ 7060398 (-)
CI01000059_07144283_07150061 NA coding upstream 332821 7143846 ~ 7152701 (-)
CI01000059_07156085_07160233 NA coding upstream 344691 7155716 ~ 7160233 (-)
G255158 NA non-coding downstream 9197 6797770 ~ 6801605 (-)
G255209 NA non-coding downstream 114459 6696050 ~ 6696343 (-)
G255205 NA non-coding downstream 120857 6689711 ~ 6689945 (-)
G255203 NA non-coding downstream 124651 6685895 ~ 6686151 (-)
G255176 NA non-coding downstream 231255 6579090 ~ 6579547 (-)
G255719 NA non-coding upstream 90465 6901490 ~ 6903467 (-)
G255691 NA non-coding upstream 121113 6932138 ~ 7046601 (-)
G255735 NA non-coding upstream 356481 7167506 ~ 7168853 (-)
G255740 NA non-coding upstream 420763 7231788 ~ 7231999 (-)
G255742 NA non-coding upstream 423090 7234115 ~ 7234338 (-)
G255092 NA other downstream 568010 6236106 ~ 6242792 (-)
G254203 NA other downstream 1572503 5237786 ~ 5238299 (-)
G253914 NA other downstream 2056720 4753538 ~ 4754082 (-)
G253013 NA other downstream 3338893 3471475 ~ 3471909 (-)
CI01000059_02096875_02098872 CDC26 other downstream 4711135 2094279 ~ 2098985 (-)
G256890 NA other upstream 2170671 8981696 ~ 8982117 (-)
G257014 NA other upstream 2643191 9454216 ~ 9599008 (-)

Expression



Co-expression Network