G255942


Basic Information

Item Value
gene id G255942
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000059
NCBI id null
chromosome length 10376574
location 8027628 ~ 8027984 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU290509
AAATGAGCTGCTGCTTTCCAGAAGAGGGCGGAGCTTTAACAGCTCACGCTTCGGTTGCTCAACAACAACAAAGCTGGAGAATCTCACGCAGCCAAAATGAGGATTGTCAGTAACGGTGTTCAGCCTTACATTGTTCAAACCGGAGTCGACACTGATGGAGAGACGTTTCTGAATGGTTAGTGGATAAATTTATGTAGTTGCTGTGGAGTTGATTCAACTCATCGACTAGCATGTGCCGTCATGTTAATCTTTTGTGCAAATCCAGCGTTGAATTGACCCTCGTTTGTGAAGCAGTCCGGCGTAAAATGACGGCATGTCAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU290509 True 320 lncRNA 0.46 2 8027628 8027984

Neighbor

gene id symbol gene type direction distance location
CI01000059_07977090_07983037 TBX3, TBX3A coding downstream 44591 7976964 ~ 7983037 (-)
CI01000059_07941129_07955904 TBX5 coding downstream 71434 7940484 ~ 7956194 (-)
CI01000059_07872877_07881890 NA coding downstream 144574 7872011 ~ 7883054 (-)
CI01000059_07796952_07805283 LMAN2L coding downstream 222345 7796791 ~ 7805283 (-)
CI01000059_07776352_07781815 ARL3.1.S, ARL3, ARL3.1 coding downstream 245813 7775975 ~ 7781815 (-)
CI01000059_08031635_08038209 NA coding upstream 2204 8030188 ~ 8038209 (-)
CI01000059_08107732_08108249 NA coding upstream 79464 8107448 ~ 8108557 (-)
CI01000059_08188428_08219512 ABL1 coding upstream 160070 8188054 ~ 8219512 (-)
CI01000059_08221332_08227552 NA coding upstream 193286 8221270 ~ 8227552 (-)
CI01000059_08251075_08251545 NA coding upstream 222970 8250954 ~ 8251545 (-)
G255927 NA non-coding downstream 58066 7963381 ~ 7969562 (-)
G255924 NA non-coding downstream 88887 7938410 ~ 7938741 (-)
G255894 NA non-coding downstream 158109 7868215 ~ 7869519 (-)
G255886 NA non-coding downstream 191560 7835389 ~ 7836068 (-)
G255964 NA non-coding upstream 43205 8071189 ~ 8071799 (-)
G255967 NA non-coding upstream 48585 8076569 ~ 8076800 (-)
G255970 NA non-coding upstream 52393 8080377 ~ 8080583 (-)
G255994 NA non-coding upstream 87294 8115278 ~ 8115480 (-)
G256584 NA non-coding upstream 100467 8128451 ~ 8164532 (-)
G255092 NA other downstream 1784836 6236106 ~ 6242792 (-)
G254203 NA other downstream 2789329 5237786 ~ 5238299 (-)
G253914 NA other downstream 3273546 4753538 ~ 4754082 (-)
G253013 NA other downstream 4555719 3471475 ~ 3471909 (-)
CI01000059_02096875_02098872 CDC26 other downstream 5927961 2094279 ~ 2098985 (-)
G256890 NA other upstream 953712 8981696 ~ 8982117 (-)
G257014 NA other upstream 1426232 9454216 ~ 9599008 (-)

Expression


Co-expression Network