G256636


Basic Information

Item Value
gene id G256636
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000059
NCBI id null
chromosome length 10376574
location 8249522 ~ 8250791 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU291287
GTGAAATATGAGTAGACAGATTAATCGAGTAGATTGATTAATATTTTTTGGACTGAAATATAAGTAGACTGATTAATCAAGTATATTGATCAATCAGTTTTGAAGTGAAATATGAGTAGATTGATTGTTTCTTTGGAGTGAAATATGAGTAGATTGATTAATCAAATAGATTGATATGAGTAGACTGATTAATCGTGTAGATTGATTCATATTTTTTGAGTGAAATATGAGTAGATTGATTAATCGATTAGAGTGATTAATATTTTTGAGTGAAATATGAGTAGATTGATTAATCGATTAGAGTGATT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU291287 True 308 lncRNA 0.26 3 8249522 8250791

Neighbor

gene id symbol gene type direction distance location
CI01000059_08221332_08227552 NA coding downstream 21970 8221270 ~ 8227552 (-)
CI01000059_08188428_08219512 ABL1 coding downstream 30010 8188054 ~ 8219512 (-)
CI01000059_08107732_08108249 NA coding downstream 140965 8107448 ~ 8108557 (-)
CI01000059_08031635_08038209 NA coding downstream 211313 8030188 ~ 8038209 (-)
CI01000059_07977090_07983037 TBX3, TBX3A coding downstream 266485 7976964 ~ 7983037 (-)
CI01000059_08251075_08251545 NA coding upstream 163 8250954 ~ 8251545 (-)
CI01000059_08263161_08266360 OXT coding upstream 12206 8262997 ~ 8266360 (-)
CI01000059_08286190_08290114 EDF1 coding upstream 35309 8286100 ~ 8290114 (-)
CI01000059_08334902_08338268 NA coding upstream 83952 8334743 ~ 8338268 (-)
CI01000059_08354408_08356482 PLPP7 coding upstream 101817 8352608 ~ 8356552 (-)
G256633 NA non-coding downstream 15014 8234221 ~ 8234508 (-)
G256571 NA non-coding downstream 66511 8181656 ~ 8183011 (-)
G256584 NA non-coding downstream 84990 8128451 ~ 8164532 (-)
G255994 NA non-coding downstream 134042 8115278 ~ 8115480 (-)
G255970 NA non-coding downstream 168939 8080377 ~ 8080583 (-)
G256643 NA non-coding upstream 10674 8261465 ~ 8261681 (-)
G256628 NA non-coding upstream 31319 8282110 ~ 8283205 (-)
G256626 NA non-coding upstream 72878 8323669 ~ 8324719 (-)
G256669 NA non-coding upstream 231733 8482524 ~ 8482767 (-)
CI01000059_08483765_08492276 NA non-coding upstream 232654 8483445 ~ 8492818 (-)
G255092 NA other downstream 2006730 6236106 ~ 6242792 (-)
G254203 NA other downstream 3011223 5237786 ~ 5238299 (-)
G253914 NA other downstream 3495440 4753538 ~ 4754082 (-)
G253013 NA other downstream 4777613 3471475 ~ 3471909 (-)
CI01000059_02096875_02098872 CDC26 other downstream 6149855 2094279 ~ 2098985 (-)
G256890 NA other upstream 730905 8981696 ~ 8982117 (-)
G257014 NA other upstream 1203425 9454216 ~ 9599008 (-)

Expression


Co-expression Network