G256643


Basic Information

Item Value
gene id G256643
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000059
NCBI id null
chromosome length 10376574
location 8261465 ~ 8261681 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU291298
CTGGCCCGTGTGGTCCGATCCAACAGACCAGCTACTGTAGCTCAAATTGCTCAAGAAGTTAATGCTGGTTCTGATAGAAAGGTGTCAGAATACACAGTGCATCAGTTTGTTGCGTATGGGGCTGCATAGCTGCAGACCAGTCAGGGTGACCATGCTGACCCCTGTCCACCGCCGAAAGAGCCAACAGTGAGCATCAGAACTGGACCACGGAGCAATG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU291298 True 217 lncRNA 0.53 1 8261465 8261681

Neighbor

gene id symbol gene type direction distance location
CI01000059_08251075_08251545 NA coding downstream 9920 8250954 ~ 8251545 (-)
CI01000059_08221332_08227552 NA coding downstream 33913 8221270 ~ 8227552 (-)
CI01000059_08188428_08219512 ABL1 coding downstream 41953 8188054 ~ 8219512 (-)
CI01000059_08107732_08108249 NA coding downstream 152908 8107448 ~ 8108557 (-)
CI01000059_08031635_08038209 NA coding downstream 223256 8030188 ~ 8038209 (-)
CI01000059_08263161_08266360 OXT coding upstream 1316 8262997 ~ 8266360 (-)
CI01000059_08286190_08290114 EDF1 coding upstream 24419 8286100 ~ 8290114 (-)
CI01000059_08334902_08338268 NA coding upstream 73062 8334743 ~ 8338268 (-)
CI01000059_08354408_08356482 PLPP7 coding upstream 90927 8352608 ~ 8356552 (-)
CI01000059_08360308_08360726 NA coding upstream 98084 8359765 ~ 8360807 (-)
G256636 NA non-coding downstream 10674 8249522 ~ 8250791 (-)
G256633 NA non-coding downstream 26957 8234221 ~ 8234508 (-)
G256571 NA non-coding downstream 78454 8181656 ~ 8183011 (-)
G256584 NA non-coding downstream 96933 8128451 ~ 8164532 (-)
G255994 NA non-coding downstream 145985 8115278 ~ 8115480 (-)
G256628 NA non-coding upstream 20429 8282110 ~ 8283205 (-)
G256626 NA non-coding upstream 61988 8323669 ~ 8324719 (-)
G256669 NA non-coding upstream 220843 8482524 ~ 8482767 (-)
CI01000059_08483765_08492276 NA non-coding upstream 221764 8483445 ~ 8492818 (-)
G256700 NA non-coding upstream 286214 8547895 ~ 8548638 (-)
G255092 NA other downstream 2018673 6236106 ~ 6242792 (-)
G254203 NA other downstream 3023166 5237786 ~ 5238299 (-)
G253914 NA other downstream 3507383 4753538 ~ 4754082 (-)
G253013 NA other downstream 4789556 3471475 ~ 3471909 (-)
CI01000059_02096875_02098872 CDC26 other downstream 6161798 2094279 ~ 2098985 (-)
G256890 NA other upstream 720015 8981696 ~ 8982117 (-)
G257014 NA other upstream 1192535 9454216 ~ 9599008 (-)

Expression


Co-expression Network