G256713


Basic Information

Item Value
gene id G256713
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000059
NCBI id null
chromosome length 10376574
location 8589332 ~ 8589537 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU291379
TCCAGCGCTAGTTTCAACAACATTGTCTTGCTTCTTTTAAAGTTGCAGTGAAAAAGACTAGGCGTTGTTTTTATTCCACTATATTGACTTCGTCAGCTGAATTCACTGTTAGATTAGATCGATTACACTAGCTATTTACTCCAAACATAGCATGCTGAGGACATCTGCTGGTTAAAGCTGTGTAAATGCAACAAGAACAGCAAAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU291379 True 206 lncRNA 0.37 1 8589332 8589537

Neighbor

gene id symbol gene type direction distance location
CI01000059_08541617_08550032 LHX3 coding downstream 39300 8541161 ~ 8550032 (-)
CI01000059_08483765_08492276 NA coding downstream 96514 8483445 ~ 8492818 (-)
CI01000059_08434015_08446002 NACC2 coding downstream 143330 8433695 ~ 8446002 (-)
CI01000059_08382830_08423907 NA coding downstream 164608 8382372 ~ 8424724 (-)
CI01000059_08360308_08360726 NA coding downstream 228525 8359765 ~ 8360807 (-)
CI01000059_09346204_09347082 NA coding upstream 756651 9346188 ~ 9348023 (-)
CI01000059_09706218_09708197 TRIM32 coding upstream 1115733 9705270 ~ 9709619 (-)
CI01000059_09783667_09789126 NA coding upstream 1194092 9783629 ~ 9789298 (-)
CI01000059_09797419_09887264 PAPPAA, PAPPA coding upstream 1207843 9797380 ~ 9887264 (-)
CI01000059_09908635_09925766 ZNF618 coding upstream 1318350 9907887 ~ 9925766 (-)
G256712 NA non-coding downstream 706 8588398 ~ 8588626 (-)
G256709 NA non-coding downstream 6958 8582039 ~ 8582374 (-)
G256700 NA non-coding downstream 40694 8547895 ~ 8548638 (-)
G256669 NA non-coding downstream 106565 8482524 ~ 8482767 (-)
G256738 NA non-coding upstream 37048 8626585 ~ 8626829 (-)
G256739 NA non-coding upstream 37357 8626894 ~ 8627118 (-)
G256696 NA non-coding upstream 50537 8640074 ~ 8710516 (-)
G256721 NA non-coding upstream 56910 8646447 ~ 8648311 (-)
G256715 NA non-coding upstream 63716 8653253 ~ 8653672 (-)
G255092 NA other downstream 2346540 6236106 ~ 6242792 (-)
G254203 NA other downstream 3351033 5237786 ~ 5238299 (-)
G253914 NA other downstream 3835250 4753538 ~ 4754082 (-)
G253013 NA other downstream 5117423 3471475 ~ 3471909 (-)
CI01000059_02096875_02098872 CDC26 other downstream 6489665 2094279 ~ 2098985 (-)
G256890 NA other upstream 392159 8981696 ~ 8982117 (-)
G257014 NA other upstream 864679 9454216 ~ 9599008 (-)

Expression


Co-expression Network