G257276



Basic Information


Item Value
gene id G257276
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000059
NCBI id null
chromosome length 10376574
location 9975614 ~ 9976040 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU291977
TATAGGGCAAAAACTATGTGTTCTTCATCTGGTTAAAAATTTAAAAGCTGTTTATTCAAGAGGCTATTTTCTGCCCTTTTACAAACTCTTGATGTTGTTTTTGGGCTCTACTAGAACAGGTTTTCCTGCTTGAATGTTGATTATTTTCCTCATATTCTCCATTGTTCAGCTCCTCTCTTCCCAGTCTGTCAGTAACGCTCTGTTTAGTTCCTGTCTCTATGAAGCCCCTCCTTCTGAAAAGCACAATGTGCTCTGATTGGTCGGCTGGAGCAGTGTGTTGTGATTGGTGTTTGGGAAATGTCCCGCCCCTTACCATAACCGCCAGTTTCAACACACTACTAACTAACTCAACCAGGCCCCGCCCCTTTATTCTGCATATGAATTATTTAAATGAGGAATATTGTGAAGAAAACTCAAGACTACAATG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU291977 True 427 lncRNA 0.41 1 9975614 9976040

Neighbor


gene id symbol gene type direction distance location
CI01000059_09908635_09925766 ZNF618 coding downstream 49848 9907887 ~ 9925766 (-)
CI01000059_09797419_09887264 PAPPAA, PAPPA coding downstream 88350 9797380 ~ 9887264 (-)
CI01000059_09783667_09789126 NA coding downstream 186316 9783629 ~ 9789298 (-)
CI01000059_09706218_09708197 TRIM32 coding downstream 265995 9705270 ~ 9709619 (-)
CI01000059_09346204_09347082 NA coding downstream 627591 9346188 ~ 9348023 (-)
CI01000059_09990989_09995182 RGS3A, RGS3 coding upstream 13463 9989503 ~ 9995251 (-)
CI01000059_09996144_10002811 NA coding upstream 20013 9996053 ~ 10002862 (-)
CI01000059_10006537_10067807 NA coding upstream 30405 10006445 ~ 10067845 (-)
CI01000059_10078245_10087217 NA coding upstream 102162 10078202 ~ 10087217 (-)
CI01000059_10112766_10123616 DNAJC25 coding upstream 136270 10112310 ~ 10123616 (-)
G257275 NA non-coding downstream 1019 9974360 ~ 9974595 (-)
G257272 NA non-coding downstream 6939 9968436 ~ 9968675 (-)
G257270 NA non-coding downstream 10346 9965042 ~ 9965268 (-)
G257245 NA non-coding downstream 199139 9776206 ~ 9776475 (-)
G257244 NA non-coding downstream 200245 9775153 ~ 9775369 (-)
G257282 NA non-coding upstream 34040 10010080 ~ 10010806 (-)
G257299 NA non-coding upstream 121676 10097716 ~ 10097915 (-)
G257063 NA non-coding upstream 140325 10116365 ~ 10204537 (-)
G257085 NA non-coding upstream 226374 10202414 ~ 10203467 (-)
G257073 NA non-coding upstream 230808 10206848 ~ 10207701 (-)
G257014 NA other downstream 376606 9454216 ~ 9599008 (-)
G256890 NA other downstream 993497 8981696 ~ 8982117 (-)
G255092 NA other downstream 3732822 6236106 ~ 6242792 (-)
G254203 NA other downstream 4737315 5237786 ~ 5238299 (-)
G253914 NA other downstream 5221532 4753538 ~ 4754082 (-)

Expression



Co-expression Network