G260201


Basic Information

Item Value
gene id G260201
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000062
NCBI id null
chromosome length 4496499
location 2372577 ~ 2372792 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU295379
TGATGACAGAATTTTTATTTTTGGGTGAGCCTTTCCTTTAATAACAACACATACAACAGTTATTTCTATTTCTCATTAATATAAACTCTAATTATACCACCGTAAATTGAAATTACCTACAATTTTGGGATCTAAAAGGCATTTCCAATTCGGTAGCAATTTATTTTACAGTCCTGTTCCCCATGTGCTTATGCTAATTACAATAACTGGGTAATA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU295379 True 216 lncRNA 0.31 1 2372577 2372792

Neighbor

gene id symbol gene type direction distance location
CI01000062_02287961_02292055 NA coding downstream 80485 2287383 ~ 2292092 (-)
CI01000062_02087992_02119506 NA coding downstream 252511 2087971 ~ 2120066 (-)
CI01000062_01787025_01788167 HTR1E, HTR1B coding downstream 584065 1787016 ~ 1788512 (-)
CI01000062_01747676_01766964 IMPG1B coding downstream 605613 1747676 ~ 1766964 (-)
CI01000062_01419375_01443524 HADHA, HADHAB coding downstream 928878 1419087 ~ 1443699 (-)
CI01000062_02400091_02406400 CMPK2 coding upstream 26962 2399754 ~ 2406400 (-)
CI01000062_02473721_02477346 IAH1 coding upstream 100742 2473534 ~ 2477346 (-)
CI01000062_02488009_02560794 ASAP2A, ASAP2, ASAP3 coding upstream 115017 2487809 ~ 2562434 (-)
CI01000062_02724898_02725662 ID2A, ID2 coding upstream 351187 2723979 ~ 2726153 (-)
CI01000062_03024898_03029604 EIF2S1A, EIF2S1B, EIF2S1 coding upstream 652087 3024879 ~ 3029696 (-)
G260200 NA non-coding downstream 333 2371936 ~ 2372244 (-)
G260198 NA non-coding downstream 6305 2365935 ~ 2366272 (-)
G260194 NA non-coding downstream 10481 2361778 ~ 2362096 (-)
G260188 NA non-coding downstream 15826 2356503 ~ 2356751 (-)
G260169 NA non-coding downstream 16770 2355284 ~ 2355807 (-)
G260202 NA non-coding upstream 4417 2377209 ~ 2377683 (-)
G260207 NA non-coding upstream 11962 2384754 ~ 2385126 (-)
G260209 NA non-coding upstream 14454 2387246 ~ 2387578 (-)
G260160 NA non-coding upstream 34236 2407028 ~ 2410972 (-)
G260167 NA non-coding upstream 110307 2483099 ~ 2484159 (-)
CI01000062_00000216_00015634 EPRS other downstream 2356865 216 ~ 15712 (-)
G261400 NA other upstream 1572643 3945435 ~ 3957385 (-)

Expression


Co-expression Network