G260391


Basic Information

Item Value
gene id G260391
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000062
NCBI id null
chromosome length 4496499
location 2896360 ~ 2896563 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU295580
CATTAAGGTTGAACCACTGTAGTCACATGAACTGTTTTAAATACGTCTTTCGTAGCTTTCTGGGCATCTGAAAGTGTTAATTATCTTGCTGTCAATAGAGGCCTCACTGAGCCATCGGATTTTATCAAAAATATCTTAATTTGTGTTCAGAAGATGAACGAAGGTCTTACGGGTGTGGAACGACATGAGGGTGAGAAATTAATG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU295580 True 204 lncRNA 0.39 1 2896360 2896563

Neighbor

gene id symbol gene type direction distance location
CI01000062_02724898_02725662 ID2A, ID2 coding downstream 170207 2723979 ~ 2726153 (-)
CI01000062_02488009_02560794 ASAP2A, ASAP2, ASAP3 coding downstream 333926 2487809 ~ 2562434 (-)
CI01000062_02473721_02477346 IAH1 coding downstream 419014 2473534 ~ 2477346 (-)
CI01000062_02400091_02406400 CMPK2 coding downstream 489960 2399754 ~ 2406400 (-)
CI01000062_02287961_02292055 NA coding downstream 604268 2287383 ~ 2292092 (-)
CI01000062_03024898_03029604 EIF2S1A, EIF2S1B, EIF2S1 coding upstream 128316 3024879 ~ 3029696 (-)
CI01000062_03033192_03047656 MPP5A, MPP5 coding upstream 136084 3032647 ~ 3047847 (-)
CI01000062_03067891_03127934 GPHNA, GPHNB, GPHN coding upstream 171043 3067606 ~ 3127934 (-)
CI01000062_03211594_03253336 FUT8A, FUT8 coding upstream 314018 3210581 ~ 3253631 (-)
CI01000062_03428921_03431581 NA coding upstream 532358 3428921 ~ 3431581 (-)
G260389 NA non-coding downstream 11324 2884775 ~ 2885036 (-)
G260383 NA non-coding downstream 15828 2862494 ~ 2880532 (-)
G260361 NA non-coding downstream 90051 2806105 ~ 2806309 (-)
G260245 NA non-coding downstream 333550 2562610 ~ 2562810 (-)
G260167 NA non-coding downstream 412201 2483099 ~ 2484159 (-)
G260418 NA non-coding upstream 21888 2918451 ~ 2918683 (-)
G261119 NA non-coding upstream 105702 3002265 ~ 3002515 (-)
G261141 NA non-coding upstream 282006 3178569 ~ 3178920 (-)
G261156 NA non-coding upstream 296825 3193388 ~ 3193908 (-)
G261163 NA non-coding upstream 302496 3199059 ~ 3199269 (-)
CI01000062_00000216_00015634 EPRS other downstream 2880648 216 ~ 15712 (-)
G261400 NA other upstream 1048872 3945435 ~ 3957385 (-)

Expression


Co-expression Network