G261326


Basic Information

Item Value
gene id G261326
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000062
NCBI id null
chromosome length 4496499
location 3795304 ~ 3795546 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU296604
AAAAAAATAAAAATTATATACTTTTTAACCACAAATGCTCATCTTGCTCTAGCTCTGCGATGCGCCACGCATTATGTAATCACGTTACAAAGGTCACACGTGACGTAGGCGGAAGTACCGAGCAAGTGTTTACAAAGCGAACGTGCAAAGACTAAGTCAAACGGTCTTTACAAAAAAAGGTAAAACAACGATTTTGGACAATTTTGAAGTTGGAGAAAATGACAGATGATTATTTCGCTAGAT

Function

NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU296604 True 243 lncRNA 0.37 1 3795304 3795546

Neighbor

gene id symbol gene type direction distance location
CI01000062_03788892_03789185 NA coding downstream 5688 3788452 ~ 3789616 (-)
CI01000062_03619844_03628631 SNX9A coding downstream 166673 3619002 ~ 3628631 (-)
CI01000062_03601436_03604051 POMCA coding downstream 190961 3601294 ~ 3604343 (-)
CI01000062_03556433_03560289 DNAJC27, DNAJC27.S, DNAJC27.L coding downstream 234291 3556203 ~ 3561013 (-)
CI01000062_03536428_03550126 NA coding downstream 244768 3535399 ~ 3550536 (-)
CI01000062_03837446_03838592 NA coding upstream 41616 3837162 ~ 3839062 (-)
CI01000062_04005001_04005527 NA coding upstream 209065 4004611 ~ 4005527 (-)
CI01000062_04005972_04008217 NA coding upstream 210370 4005916 ~ 4008380 (-)
CI01000062_04021845_04022218 EVA1A coding upstream 225931 4021477 ~ 4022218 (-)
CI01000062_04054548_04067692 GCFC2 coding upstream 258921 4054467 ~ 4067970 (-)
G261302 NA non-coding downstream 79087 3715212 ~ 3716217 (-)
G261285 NA non-coding downstream 96288 3698814 ~ 3699016 (-)
G261248 NA non-coding downstream 139913 3655159 ~ 3655391 (-)
G261239 NA non-coding downstream 179389 3615490 ~ 3615915 (-)
G261204 NA non-coding downstream 217330 3575913 ~ 3577974 (-)
G261329 NA non-coding upstream 5457 3801003 ~ 3801340 (-)
G261255 NA non-coding upstream 32301 3827847 ~ 3828434 (-)
G261251 NA non-coding upstream 50888 3846434 ~ 3852053 (-)
G261249 NA non-coding upstream 83498 3879044 ~ 3882537 (-)
CI01000062_00000216_00015634 EPRS other downstream 3779592 216 ~ 15712 (-)
G261400 NA other upstream 149889 3945435 ~ 3957385 (-)

Expression


Co-expression Network