CI01000063_01662111_01665744 (AQP8A.2, AQP8, AQP8A.1)


Basic Information

Item Value
gene id CI01000063_01662111_01665744
gene name AQP8A.2, AQP8, AQP8A.1
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000063
NCBI id null
chromosome length 7808773
location 1662111 ~ 1665744 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000063_01662111_01665744.mRNA
GGGTGGAATATCAGGAGCATGTATGAATCCAGCAAGGGCCTTTGGGCCAGCGATAGTGTCCGGTCACTGGACGTACCACTGGGTATATTGGGTGGGACCTTTGGCTGCGGATCACATTTCAACCCTCCATTCACCATCGCTATCTGGTTGTGTGGTGGAATGCAGCTGACGATGGTTGTTCCCTACCTTATCAGTCAGCTTATCGGAGGTGTGCTGGGAGCTGTAATGTCAAAGGTTATGACATCACACGAGAACTACATGAATGCTACCGGAGCGGCCTTTACTATTCTTACGTCTGATGAGCAGCTGGGGAAGGTTGTGTTTGCTGAAATGGCCATGACATGTCTAGTAACCATGGTAGTGCTGTTGGGGGCAGTCAATGGAAAGAGCAAAAGCCCCCTGGTGCCCTTCATGGTGGGCTGCACTGTTATCGTCAATATTCTGGCAGG

Function

symbol description
aqp8a.1 Enables urea transmembrane transporter activity and water transmembrane transporter activity. Predicted to act upstream of or within transmembrane transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in several structures, including cardiovascular system; eye; liver; mesoderm; and pleuroperitoneal region. Orthologous to human AQP8 (aquaporin 8).
aqp8a.2 Enables urea transmembrane transporter activity and water transmembrane transporter activity. Predicted to act upstream of or within transmembrane transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in intestinal bulb; intestine; kidney; mid intestine; and posterior intestine. Orthologous to human AQP8 (aquaporin 8).
aqp8 Predicted to enable water channel activity. Involved in cellular response to cAMP. Located in apical part of cell.

NR:

description
Aquaporin 8a

GO:

id name namespace
GO:0009992 cellular water homeostasis biological_process

KEGG:

id description
K09869 AQP8; aquaporin-8

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000063_01662111_01665744.mRNA True 449 mRNA 0.51 3 1662111 1665744

Neighbor

gene id symbol gene type direction distance location
CI01000063_01658882_01660951 AQP8A.1 coding upstream 969 1658882 ~ 1661142 (+)
CI01000063_01643090_01644021 NA coding upstream 17674 1642653 ~ 1644437 (+)
CI01000063_01563309_01595922 GRID2IP, GRID2IPB coding upstream 66189 1563309 ~ 1595922 (+)
CI01000063_01544850_01548093 MLST8, MLST8.L coding upstream 113777 1544786 ~ 1548334 (+)
CI01000063_01537233_01540577 NA coding upstream 121477 1537233 ~ 1540634 (+)
CI01000063_01672649_01673337 HBBE2 coding downstream 6830 1672574 ~ 1673385 (+)
CI01000063_01675750_01678399 HBBE3 coding downstream 9757 1675501 ~ 1678458 (+)
CI01000063_01692878_01697954 NA coding downstream 26650 1692394 ~ 1698078 (+)
CI01000063_01739754_01764028 RHBDF1B, RHBDF1, RHBDF1A coding downstream 73500 1739244 ~ 1764772 (+)
CI01000063_01784971_01788682 NA coding downstream 119227 1784971 ~ 1788898 (+)
G262101 NA non-coding upstream 6062 1655202 ~ 1656049 (+)
CI01000063_01533946_01534527 MSRB1B non-coding upstream 126736 1533853 ~ 1535375 (+)
G262266 NA non-coding upstream 152483 1509279 ~ 1509628 (+)
G262211 NA non-coding upstream 463274 1196368 ~ 1198837 (+)
G262194 NA non-coding upstream 517104 1139352 ~ 1145007 (+)
G262104 NA non-coding downstream 16475 1682219 ~ 1686364 (+)
G262314 NA non-coding downstream 72054 1737798 ~ 1738321 (+)
G262333 NA non-coding downstream 140220 1805964 ~ 1806185 (+)
G262122 NA non-coding downstream 145764 1811508 ~ 1813486 (+)
G262098 NA non-coding downstream 184612 1850356 ~ 1854092 (+)
G262060 NA other upstream 951557 710110 ~ 710554 (+)
G261984 NA other upstream 994729 665800 ~ 667382 (+)
CI01000063_00533801_00557577 MPP3B other upstream 1103777 533801 ~ 558334 (+)
G261700 NA other upstream 1387661 252412 ~ 274450 (+)
G262423 NA other downstream 575664 2241408 ~ 2242965 (+)
G262436 NA other downstream 1047871 2713615 ~ 2714517 (+)
G265391 NA other downstream 4248039 5913783 ~ 5919029 (+)
CI01000063_06335618_06338138 HOXB8B other downstream 4669534 6335618 ~ 6338283 (+)

Expression


Co-expression Network