CI01000063_02326799_02327290 (CBY1)


Basic Information

Item Value
gene id CI01000063_02326799_02327290
gene name CBY1
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000063
NCBI id null
chromosome length 7808773
location 2326741 ~ 2327309 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000063_02326799_02327290.mRNA
ATGCCCTTGTTTGGCAACACTTTTAGTCCCAAGAAAACCCCTCCTCGGAAGTCTGCTTCCCTTTCCAATCTACATACATTGGATCGGTCAACACGGGAGATTGAATTAGGTCTGGAATATGGATACCCGATGATGAATCTTGGCAGCCAGAGCTTTAAATTTGAAGATGGCCAGTGGATCTCAGAGTCAGGAGGTAATGTATCTGGAAGAGAGGTACAGCGACTGAAGAAGAGGAATCTACAGTTAGAGGAGGAGAATAATCTGCTTAGGCTAAAGATTGAGGTTCTTCTTGATATGGTGAGTGTTGAATGAATATAATGCTGAAAGCCACCATGGCTTGAAAAATATATAGACTAAATCTAATAATAAA

Function

symbol description
cby1 Orthologous to human CBY1 (chibby family member 1, beta catenin antagonist).

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000063_02326799_02327290.mRNA False 370 mRNA 0.41 3 2326741 2327290

Neighbor

gene id symbol gene type direction distance location
CI01000063_02321620_02324262 NA coding downstream 2176 2321544 ~ 2324565 (-)
CI01000063_02317828_02320348 NA coding downstream 6393 2317361 ~ 2320348 (-)
CI01000063_02293142_02305535 SH3BP1 coding downstream 21206 2292193 ~ 2305535 (-)
CI01000063_02234891_02253083 NA coding downstream 73658 2233613 ~ 2253083 (-)
CI01000063_02225053_02232182 CSNK1E coding downstream 94559 2224887 ~ 2232182 (-)
CI01000063_02357993_02360597 PHF5A, BRAFLDRAFT_57503 coding upstream 30636 2357926 ~ 2360597 (-)
CI01000063_02404812_02415053 KCTD17, KCD17 coding upstream 76852 2404142 ~ 2415053 (-)
CI01000063_02416343_02425379 NA coding upstream 88983 2416273 ~ 2425636 (-)
CI01000063_02444203_02454140 L3MBTL2 coding upstream 116859 2444149 ~ 2454281 (-)
CI01000063_02496694_02509735 JOSD1 coding upstream 168722 2496012 ~ 2509735 (-)
G263405 NA non-coding downstream 306139 2020363 ~ 2020602 (-)
G263394 NA non-coding downstream 330637 1995766 ~ 1996104 (-)
G263260 NA non-coding downstream 337887 1949847 ~ 1988854 (-)
G263356 NA non-coding downstream 416371 1910148 ~ 1910370 (-)
G263350 NA non-coding downstream 425200 1901329 ~ 1901541 (-)
G263201 NA non-coding upstream 25892 2353182 ~ 2356169 (-)
G263207 NA non-coding upstream 39731 2367021 ~ 2369202 (-)
G263430 NA non-coding upstream 53122 2380412 ~ 2381248 (-)
G263431 NA non-coding upstream 54056 2381346 ~ 2383423 (-)
CI01000063_02177769_02178239 NA other downstream 148405 2177747 ~ 2178395 (-)
CI01000063_01669384_01670016 HBAE1 other downstream 656665 1669317 ~ 1672019 (-)
CI01000063_02725759_02726399 NA other upstream 398469 2725759 ~ 2726535 (-)
G265567 NA other upstream 2835204 5183279 ~ 5183287 (-)
CI01000063_05189361_05189645 CRIPT other upstream 2861113 5188403 ~ 5189645 (-)
CI01000063_05616519_05617045 NA other upstream 3219411 5615806 ~ 5617112 (-)
G265976 NA other upstream 3960868 6283058 ~ 6290946 (-)

Expression


Co-expression Network