CI01000063_05627849_05635031 (SNCGB, SNCG, SNCA)


Basic Information

Item Value
gene id CI01000063_05627849_05635031
gene name SNCGB, SNCG, SNCA
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000063
NCBI id null
chromosome length 7808773
location 5627758 ~ 5635031 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000063_05627849_05635031.mRNA
AAGAACAGAAAACAGCTGGTATACTCACCTGCAAATCACTGGCAGGGAGCTGACCATCTGACGCACAGCAGAGTGGGAGAGCAACCCTGTCTGATTCCATCAGAGATTACTGCTCTCAGGCCTCAGGGGTCCTTCACAGCCTCTATTTCCTGTGTCAATCATCATTCTGTGGTCCTTAACCAATCCACAGCCACCAGGTGGGTTGATATTTACTATCATCATCCAATCACATCGCATCACACCAAAGAATTCCTGCTGAGCTGTGACTTTCAGCTGACTATTCTTATATTTTTAGCATGGAAAGCCCAATCCATCTGCAGAGCACCATCGTCAAACTCAACGTCCAGGATGGATGTTCTAATGAAGGGATTCTCCATGGCCAAGGAAGGAGTGGTGGCCGCCGCTGAGAAAACTAAAGCTGGGGTTGAAGAGGCAGCTCTCAGGACCAAGGAAGGGGTCATGTATGTGGGTAACAAGACAAAGGAGGGAGTGGTGTCAGGCGTAAACACAGTTGCCAATAGGACCACCGACCAGGCGAATATTGTGGGTGAAACAGCGGTAGGCAGCGCTAATGACATGGGACAGAAGACAGTAGAGGGGCTGGAGAACGTGGGTGCATCAACCGGCATGGTCAACCCGGTGTATTGCGTTTCAAAGACCTTTGAATTACTTAAGTCTAGCTTGAGGGATCTATGTCTTACCTGGGTTAACCACAAAAGGCAGTTTTGTGTGATAATACTGCAGTGTACTATAGCTACTGTAGAAATGCTGTATGTTGTGTCTAACATATTCTGTTTGTTTCCCCCCTGGACAACTGTGCTATTGACAGGATGAGGCTTTATATGAGGTGCTTATGAAATGGGGTTGGGAATGGTGGTTTAGTTTGTAGAAAGAAATGTGCTACAGCCTGTGAATGTGGAATATA

Function

symbol description
sncgb Predicted to enable cuprous ion binding activity. Acts upstream of or within dopaminergic neuron differentiation and larval locomotory behavior. Predicted to be active in axon terminus; cytoplasm; and neuronal cell body. Is expressed in basal plate midbrain region; gill; nervous system; testis; and trigeminal placode. Human ortholog(s) of this gene implicated in Lewy body dementia. Orthologous to human SNCG (synuclein gamma).
snca Enables several functions, including Hsp70 protein binding activity; cytoskeletal protein binding activity; and metal ion binding activity. Involved in several processes, including negative regulation of transport; positive regulation of transport; and regulation of protein metabolic process. Located in several cellular components, including growth cone; inclusion body; and perinuclear region of cytoplasm. Part of protein-containing complex. Colocalizes with platelet alpha granule membrane. Implicated in Alzheimer's disease; Lewy body dementia; Parkinson's disease; Parkinson's disease 1; and Parkinson's disease 4. Biomarker of several diseases, including Creutzfeldt-Jakob disease; Lewy body dementia; bipolar disorder; neurodegenerative disease (multiple); and vascular dementia.
sncg Predicted to enable cuprous ion binding activity. Predicted to be involved in several processes, including chemical synaptic transmission; regulation of neuron death; and synaptic vesicle endocytosis. Predicted to act upstream of or within adult locomotory behavior; regulation of dopamine secretion; and regulation of neurotransmitter secretion. Located in centrosome and cytoplasm. Implicated in Lewy body dementia. Biomarker of several diseases, including Lewy body dementia; neurodegenerative disease (multiple); pancreatic cancer; retinoblastoma; and vascular dementia.

GO:

id name namespace
GO:0008345 larval locomotory behavior biological_process

KEGG:

id description
K04528 SNCA; alpha-synuclein

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000063_05627849_05635031.mRNA True 925 mRNA 0.47 6 5627758 5635031

Neighbor

gene id symbol gene type direction distance location
CI01000063_05616519_05617045 NA coding downstream 10685 5615806 ~ 5617112 (-)
CI01000063_05473346_05474995 SIX2B, SIX2A, SIX2 coding downstream 152001 5473338 ~ 5475757 (-)
CI01000063_05353701_05355458 ZFP36L2 coding downstream 271474 5352758 ~ 5356284 (-)
CI01000063_05304502_05306803 HCAR1-4 coding downstream 320955 5304439 ~ 5306803 (-)
CI01000063_05257128_05262520 KCNG3 coding downstream 364427 5256958 ~ 5263331 (-)
CI01000063_05652987_05657351 BMPR1AB, BMPR1A, BMPR1AA coding upstream 17245 5652276 ~ 5657351 (-)
CI01000063_05689441_05689773 NA coding upstream 53272 5688303 ~ 5689881 (-)
CI01000063_05690755_05712496 LDB3B, LDB3 coding upstream 55233 5690264 ~ 5712923 (-)
CI01000063_05729622_05743365 OPN4B coding upstream 94591 5729622 ~ 5743365 (-)
CI01000063_05783589_05833813 USP54B, USP54 coding upstream 148558 5783589 ~ 5834724 (-)
G265793 NA non-coding downstream 61382 5559531 ~ 5566376 (-)
G265742 NA non-coding downstream 178380 5449092 ~ 5449378 (-)
G265733 NA non-coding downstream 213090 5414430 ~ 5414668 (-)
G265732 NA non-coding downstream 213891 5413427 ~ 5413867 (-)
G265714 NA non-coding downstream 250782 5376744 ~ 5376976 (-)
CI01000063_05950749_05954473 NA non-coding upstream 263341 5949613 ~ 5954558 (-)
G265890 NA non-coding upstream 287486 5922517 ~ 5926035 (-)
G265889 NA non-coding upstream 293711 5928742 ~ 5931804 (-)
G265802 NA non-coding upstream 503660 6138691 ~ 6151199 (-)
G265789 NA non-coding upstream 540646 6175677 ~ 6177315 (-)
G265567 NA other downstream 373818 5183279 ~ 5183287 (-)
CI01000063_05189361_05189645 CRIPT other downstream 437141 5188403 ~ 5189645 (-)
CI01000063_02725759_02726399 NA other downstream 2901223 2725759 ~ 2726535 (-)
CI01000063_02326799_02327290 CBY1 other downstream 3300039 2326741 ~ 2327309 (-)
G265976 NA other upstream 653127 6283058 ~ 6290946 (-)
G266797 NA other upstream 1654464 7289495 ~ 7290224 (-)
G266660 NA other upstream 1804054 7439085 ~ 7441435 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_005370 sncgb coding NC_007123.7 CM002896.2 25894539 ~ 25916530 (-)