G262845


Basic Information

Item Value
gene id G262845
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000063
NCBI id null
chromosome length 7808773
location 673440 ~ 673969 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU298345
CAGTTCACCACTATGATCAGTAAAATAGAGTTTGACTTACTTGTAGTCTTTTTCCATATTAGAAAACAGCTCCATAAACTCTGTGGTGACTTCTTCACGAATACGAGATTCCATAGTTAATTTTTCAGACTCCTCTTTGGACAGCTTCTCTTTGAGCTCTTCAATTTTCACCTGAAGCTCACACAGCTCTTGACTTTCCACAGCCTCTAACACAGTGTTGTCCTCCATGCTCTCATCGCCACTCTCTACATCTTCCTCACCAATTTCTTCATCATCTTCATCCTCCTGCACATCCTCTAGACTCATCTCCCAGCCCATGAGTGAGCTTCTCCTGGTCCAATCTTTCTTGTCAGCATTATTGATTATCATAGACACATCTCTGGCAGATCTCTTGAGCACAACGCTAGGAGCTGGTTTAGGGTTGAGGACC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU298345 True 430 lncRNA 0.43 2 673440 673969

Neighbor

gene id symbol gene type direction distance location
CI01000063_00667915_00668974 RPP30 coding downstream 4466 667839 ~ 668974 (-)
CI01000063_00662883_00664247 NA coding downstream 9193 662715 ~ 664247 (-)
CI01000063_00638505_00652571 PCGF5B coding downstream 20869 636794 ~ 652571 (-)
CI01000063_00584683_00604437 HECTD2, HECD2 coding downstream 69003 583409 ~ 604437 (-)
CI01000063_00443887_00450411 NA coding downstream 221998 443255 ~ 451442 (-)
CI01000063_00715092_00717330 HTR7 coding upstream 39600 713569 ~ 717808 (-)
CI01000063_00732118_00733108 NA coding upstream 57621 731590 ~ 734005 (-)
CI01000063_00792983_00795702 NA coding upstream 118467 792436 ~ 799214 (-)
CI01000063_00805911_00806593 NA coding upstream 131942 805911 ~ 806632 (-)
CI01000063_00808299_00809636 NA coding upstream 134091 808060 ~ 809636 (-)
G262831 NA non-coding downstream 51897 621050 ~ 621543 (-)
G262829 NA non-coding downstream 54800 618410 ~ 618640 (-)
G262816 NA non-coding downstream 101693 571522 ~ 571747 (-)
G262797 NA non-coding downstream 115129 552818 ~ 558311 (-)
G262755 NA non-coding downstream 163830 504498 ~ 509610 (-)
G262844 NA non-coding upstream 11975 685944 ~ 686351 (-)
G262849 NA non-coding upstream 21133 695102 ~ 695494 (-)
G262853 NA non-coding upstream 35287 709256 ~ 709612 (-)
G262854 NA non-coding upstream 36120 710089 ~ 710563 (-)
G262913 NA non-coding upstream 151240 825209 ~ 825433 (-)
CI01000063_01669384_01670016 HBAE1 other upstream 995442 1669317 ~ 1672019 (-)
CI01000063_02177769_02178239 NA other upstream 1502470 2177747 ~ 2178395 (-)
CI01000063_02326799_02327290 CBY1 other upstream 1651143 2326741 ~ 2327309 (-)
CI01000063_02725759_02726399 NA other upstream 2051790 2725759 ~ 2726535 (-)
G265567 NA other upstream 4488525 5183279 ~ 5183287 (-)

Expression


Co-expression Network