G263004


Basic Information

Item Value
gene id G263004
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000063
NCBI id null
chromosome length 7808773
location 1154399 ~ 1154613 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU298536
GTTTGGTTCAGGGTTAGTTGAGAGTAATTATGTATAATTTACTGTTATTACTATAGTAAGTACATGTAACGTGTAAAAGGCACTTTACAATAATGTGTTACCTTATTGTGTTGAAGTAAATAATTTTTTTATTAATATTTATGCAAACAATAAATAAAATATATGGAAAGAATCAGGACATGCAATGTTTGGCCACAAAGGCTGTTTAATCTGCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU298536 True 215 lncRNA 0.28 1 1154399 1154613

Neighbor

gene id symbol gene type direction distance location
CI01000063_01143887_01144418 PVALB3, PVALB2, PRV2 coding downstream 9459 1143203 ~ 1144940 (-)
CI01000063_01133174_01140538 PVALB, PVALB3, MGC80184, PVALB4 coding downstream 13861 1133012 ~ 1140538 (-)
CI01000063_01115076_01126539 CCZ1 coding downstream 27860 1114647 ~ 1126539 (-)
CI01000063_01103201_01112981 NA coding downstream 41418 1103116 ~ 1112981 (-)
CI01000063_01079985_01087813 EIF2AK1 coding downstream 66586 1079522 ~ 1087813 (-)
CI01000063_01170694_01187133 TECPR1, TECPR1A coding upstream 15669 1170282 ~ 1187133 (-)
CI01000063_01188049_01192674 TECPR1, TECPR1A coding upstream 33436 1188049 ~ 1192674 (-)
CI01000063_01200458_01207989 NA coding upstream 45775 1200388 ~ 1207989 (-)
CI01000063_01216041_01217287 NA coding upstream 61102 1215715 ~ 1217563 (-)
CI01000063_01228002_01232509 NPTX2B, NPTX2 coding upstream 71860 1226473 ~ 1232993 (-)
G263002 NA non-coding downstream 1272 1152889 ~ 1153127 (-)
G262999 NA non-coding downstream 4530 1149612 ~ 1149869 (-)
G262990 NA non-coding downstream 56267 1097440 ~ 1098132 (-)
G262988 NA non-coding downstream 58776 1095347 ~ 1095623 (-)
G262985 NA non-coding downstream 59686 1093632 ~ 1094713 (-)
G262997 NA non-coding upstream 1103 1155716 ~ 1155952 (-)
G263029 NA non-coding upstream 126414 1281027 ~ 1281776 (-)
G263021 NA non-coding upstream 156128 1310741 ~ 1329440 (-)
CI01000063_01329725_01330246 NA non-coding upstream 175450 1329711 ~ 1330272 (-)
G263071 NA non-coding upstream 181981 1336594 ~ 1336815 (-)
CI01000063_01669384_01670016 HBAE1 other upstream 514798 1669317 ~ 1672019 (-)
CI01000063_02177769_02178239 NA other upstream 1021826 2177747 ~ 2178395 (-)
CI01000063_02326799_02327290 CBY1 other upstream 1170499 2326741 ~ 2327309 (-)
CI01000063_02725759_02726399 NA other upstream 1571146 2725759 ~ 2726535 (-)
G265567 NA other upstream 4007881 5183279 ~ 5183287 (-)

Expression


Co-expression Network