G263278


Basic Information

Item Value
gene id G263278
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000063
NCBI id null
chromosome length 7808773
location 1665530 ~ 1665799 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU298852
GTAACTGGTCACGGCCCTGGCCATGCTATTAAGATTTATTTCGTTCCAGACTTACCCTGCCAGAATATTGACGATAACAGTGCAGCCCACCATGAAGGGCACCAGGGGGCTTTTGCTCTTTCCATTGACTGCCCCCAACAGCACTACCATGGTTACTAGACATGTCATGGCCATTTCAGCAAACACAACCTTCCCCAGCTGCTCATCAGACGTAAGAATAGTAAAGGCCGCTCCGGTAGCATTCATGTAGTTCTCGTGTGATGTCATAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU298852 True 270 lncRNA 0.49 1 1665530 1665799

Neighbor

gene id symbol gene type direction distance location
CI01000063_01603848_01622589 NA coding downstream 42744 1603474 ~ 1622786 (-)
CI01000063_01557732_01560541 ZDHHC4 coding downstream 104989 1557653 ~ 1560541 (-)
CI01000063_01554604_01555607 PGP coding downstream 109923 1553980 ~ 1555607 (-)
CI01000063_01548731_01553329 BRICD5 coding downstream 112201 1548447 ~ 1553329 (-)
CI01000063_01541176_01541412 NA coding downstream 122959 1541086 ~ 1542571 (-)
CI01000063_01669384_01670016 HBAE1 coding upstream 3518 1669317 ~ 1672019 (-)
CI01000063_01682341_01683245 NA coding upstream 16480 1682279 ~ 1683245 (-)
CI01000063_01802070_01805063 FOXJ1B coding upstream 135903 1801702 ~ 1805475 (-)
CI01000063_01809470_01817028 MGRN1A coding upstream 143596 1809395 ~ 1817028 (-)
CI01000063_01856270_01877031 MKL2A, MKL2 coding upstream 190446 1856245 ~ 1877095 (-)
G263277 NA non-coding downstream 452 1664634 ~ 1665078 (-)
G263275 NA non-coding downstream 5560 1659557 ~ 1659970 (-)
G263274 NA non-coding downstream 7571 1657540 ~ 1657959 (-)
G263271 NA non-coding downstream 10163 1655022 ~ 1655367 (-)
G263131 NA non-coding downstream 32974 1629827 ~ 1632556 (-)
G263279 NA non-coding upstream 1150 1666949 ~ 1667844 (-)
G263283 NA non-coding upstream 21500 1687299 ~ 1687525 (-)
G263286 NA non-coding upstream 24959 1690758 ~ 1691170 (-)
G263287 NA non-coding upstream 25968 1691767 ~ 1692242 (-)
G263284 NA non-coding upstream 29755 1695554 ~ 1695729 (-)
CI01000063_02177769_02178239 NA other upstream 510640 2177747 ~ 2178395 (-)
CI01000063_02326799_02327290 CBY1 other upstream 659313 2326741 ~ 2327309 (-)
CI01000063_02725759_02726399 NA other upstream 1059960 2725759 ~ 2726535 (-)
G265567 NA other upstream 3496695 5183279 ~ 5183287 (-)

Expression


Co-expression Network