G263284


Basic Information

Item Value
gene id G263284
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000063
NCBI id null
chromosome length 7808773
location 1695554 ~ 1695729 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU298858
GAGTAAAGATAACATGCACTACACATAGGTAAAGACGACGCCGAACAATGAGAAAAGAAAGAACTGAGGACTTAAATATACACACTTATGATTATCTGAACAATAAACAGCTGCAAAACTCAATCAGTAACCATGACAACTAAGAGATCGGAACACAGGAAAACAACAATATAATT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU298858 True 176 lncRNA 0.35 1 1695554 1695729

Neighbor

gene id symbol gene type direction distance location
CI01000063_01682341_01683245 NA coding downstream 12309 1682279 ~ 1683245 (-)
CI01000063_01669384_01670016 HBAE1 coding downstream 23535 1669317 ~ 1672019 (-)
CI01000063_01603848_01622589 NA coding downstream 72768 1603474 ~ 1622786 (-)
CI01000063_01557732_01560541 ZDHHC4 coding downstream 135013 1557653 ~ 1560541 (-)
CI01000063_01554604_01555607 PGP coding downstream 139947 1553980 ~ 1555607 (-)
CI01000063_01802070_01805063 FOXJ1B coding upstream 105973 1801702 ~ 1805475 (-)
CI01000063_01809470_01817028 MGRN1A coding upstream 113666 1809395 ~ 1817028 (-)
CI01000063_01856270_01877031 MKL2A, MKL2 coding upstream 160516 1856245 ~ 1877095 (-)
CI01000063_01890725_01899483 ERCC4 coding upstream 194663 1890392 ~ 1899546 (-)
CI01000063_01915989_01944590 CPPED1 coding upstream 219694 1915423 ~ 1944590 (-)
G263287 NA non-coding downstream 3312 1691767 ~ 1692242 (-)
G263286 NA non-coding downstream 4384 1690758 ~ 1691170 (-)
G263283 NA non-coding downstream 8029 1687299 ~ 1687525 (-)
G263279 NA non-coding downstream 27710 1666949 ~ 1667844 (-)
G263278 NA non-coding downstream 29755 1665530 ~ 1665799 (-)
G263285 NA non-coding upstream 2041 1697770 ~ 1698235 (-)
G263290 NA non-coding upstream 8488 1704217 ~ 1704452 (-)
G263291 NA non-coding upstream 9548 1705277 ~ 1705482 (-)
G263292 NA non-coding upstream 12308 1708037 ~ 1708326 (-)
G263133 NA non-coding upstream 13969 1709698 ~ 1711337 (-)
CI01000063_02177769_02178239 NA other upstream 480710 2177747 ~ 2178395 (-)
CI01000063_02326799_02327290 CBY1 other upstream 629383 2326741 ~ 2327309 (-)
CI01000063_02725759_02726399 NA other upstream 1030030 2725759 ~ 2726535 (-)
G265567 NA other upstream 3466765 5183279 ~ 5183287 (-)
CI01000063_05189361_05189645 CRIPT other upstream 3492674 5188403 ~ 5189645 (-)

Expression


Co-expression Network