G263431


Basic Information

Item Value
gene id G263431
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000063
NCBI id null
chromosome length 7808773
location 2381346 ~ 2383423 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU299022
ACAAAACTCTTCTGTTGTTGCAAACTACTAATGTACAATATCACTACATACTCACCAGAAACAGTCCTCTGTGTTATTCTGCTTCTTGTATATAAACGTTGTGCTCCATACAGGCTTGAGAGTATCATTGAAATTCCAAAAGTGAGAGAAGAAGCTGGAGATTTTTCTAGCTGGAGGCAGAAGGCGAGTCAGATCTCTCTTGAAGTCACAAGACAATCCAAAGCTTCCTGCTGATATGATGGGCATGTTGAGGTTCAGACCGATCTCCAAGTCAACCATTTGGAAAGTGGCATAAGTGCAGGTTGGTCCCAGTAGAGCACATCCCTCCTCCCCTGCATTCGCAAGATCATTTAAAATTTCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU299022 True 361 lncRNA 0.42 3 2381346 2383423

Neighbor

gene id symbol gene type direction distance location
CI01000063_02357993_02360597 PHF5A, BRAFLDRAFT_57503 coding downstream 20749 2357926 ~ 2360597 (-)
CI01000063_02326799_02327290 CBY1 coding downstream 54056 2326741 ~ 2327309 (-)
CI01000063_02321620_02324262 NA coding downstream 56781 2321544 ~ 2324565 (-)
CI01000063_02317828_02320348 NA coding downstream 60998 2317361 ~ 2320348 (-)
CI01000063_02293142_02305535 SH3BP1 coding downstream 75811 2292193 ~ 2305535 (-)
CI01000063_02404812_02415053 KCTD17, KCD17 coding upstream 20719 2404142 ~ 2415053 (-)
CI01000063_02416343_02425379 NA coding upstream 32850 2416273 ~ 2425636 (-)
CI01000063_02444203_02454140 L3MBTL2 coding upstream 60726 2444149 ~ 2454281 (-)
CI01000063_02496694_02509735 JOSD1 coding upstream 112589 2496012 ~ 2509735 (-)
CI01000063_02512138_02519529 XRCC6 coding upstream 128509 2511932 ~ 2519537 (-)
G263430 NA non-coding downstream 98 2380412 ~ 2381248 (-)
G263207 NA non-coding downstream 12144 2367021 ~ 2369202 (-)
G263201 NA non-coding downstream 25177 2353182 ~ 2356169 (-)
G263405 NA non-coding downstream 360744 2020363 ~ 2020602 (-)
G263394 NA non-coding downstream 385242 1995766 ~ 1996104 (-)
G263250 NA non-coding upstream 47954 2431377 ~ 2432091 (-)
G263442 NA non-coding upstream 51677 2435100 ~ 2435311 (-)
G263443 NA non-coding upstream 52088 2435511 ~ 2435757 (-)
G263444 NA non-coding upstream 52683 2436106 ~ 2436318 (-)
CI01000063_02177769_02178239 NA other downstream 203010 2177747 ~ 2178395 (-)
CI01000063_01669384_01670016 HBAE1 other downstream 711270 1669317 ~ 1672019 (-)
CI01000063_02725759_02726399 NA other upstream 342336 2725759 ~ 2726535 (-)
G265567 NA other upstream 2779071 5183279 ~ 5183287 (-)
CI01000063_05189361_05189645 CRIPT other upstream 2804980 5188403 ~ 5189645 (-)
CI01000063_05616519_05617045 NA other upstream 3163278 5615806 ~ 5617112 (-)
G265976 NA other upstream 3904735 6283058 ~ 6290946 (-)

Expression


Co-expression Network