G264312


Basic Information

Item Value
gene id G264312
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000063
NCBI id null
chromosome length 7808773
location 3002798 ~ 3006270 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU299987
ATGATTAGCTATAAAAGGGATGTCTTAGAGAGGCAGAGTCTCTCAGAAGTAAAGATGGGCAGATCTGTGAAAGAGTGCATAAAAAGATTGTGGAATACTTTAAAAACAATGTTCCTCAATGTCAAATTGCAAAGGCTTTGCAAATCTCATCATTTACAGTGCATAACATCATCAAAAGATTCAGAGAAACTAGAGAAATCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU299987 True 201 lncRNA 0.35 2 3002798 3006270

Neighbor

gene id symbol gene type direction distance location
CI01000063_02990060_02990880 NA coding downstream 11331 2988694 ~ 2991467 (-)
CI01000063_02725759_02726399 NA coding downstream 276264 2725759 ~ 2726535 (-)
CI01000063_02707551_02721566 SNF8 coding downstream 281232 2706964 ~ 2721582 (-)
CI01000063_02675583_02681052 NA coding downstream 321746 2674054 ~ 2681052 (-)
CI01000063_02656350_02661590 SLC16A6A coding downstream 340998 2656345 ~ 2661800 (-)
CI01000063_03296061_03306819 EME1 coding upstream 289664 3295934 ~ 3306819 (-)
CI01000063_03373714_03386774 TR-ALPHA, THRAA, THRAB, THRA coding upstream 366773 3373043 ~ 3386774 (-)
CI01000063_03426029_03462400 NA coding upstream 419336 3425606 ~ 3463898 (-)
CI01000063_03615200_03619061 ORMDL2, ORMDL3 coding upstream 608866 3615136 ~ 3620436 (-)
CI01000063_03628232_03633396 NA coding upstream 621807 3628077 ~ 3633446 (-)
G263646 NA non-coding downstream 77751 2924831 ~ 2925047 (-)
G263624 NA non-coding downstream 103200 2899360 ~ 2899598 (-)
G263572 NA non-coding downstream 166002 2836538 ~ 2836796 (-)
G263525 NA non-coding downstream 203450 2794285 ~ 2799348 (-)
G263500 NA non-coding downstream 262832 2734909 ~ 2739966 (-)
G264314 NA non-coding upstream 7553 3013823 ~ 3014146 (-)
G264319 NA non-coding upstream 34546 3040816 ~ 3041073 (-)
G264323 NA non-coding upstream 53832 3060102 ~ 3060314 (-)
G264363 NA non-coding upstream 137593 3143863 ~ 3144167 (-)
G264466 NA non-coding upstream 265896 3272166 ~ 3272476 (-)
CI01000063_02326799_02327290 CBY1 other downstream 675079 2326741 ~ 2327309 (-)
CI01000063_02177769_02178239 NA other downstream 824462 2177747 ~ 2178395 (-)
CI01000063_01669384_01670016 HBAE1 other downstream 1332722 1669317 ~ 1672019 (-)
G265567 NA other upstream 2156224 5183279 ~ 5183287 (-)
CI01000063_05189361_05189645 CRIPT other upstream 2182133 5188403 ~ 5189645 (-)
CI01000063_05616519_05617045 NA other upstream 2540431 5615806 ~ 5617112 (-)
G265976 NA other upstream 3281888 6283058 ~ 6290946 (-)
G266797 NA other upstream 4283225 7289495 ~ 7290224 (-)

Expression


Co-expression Network