G264466


Basic Information

Item Value
gene id G264466
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000063
NCBI id null
chromosome length 7808773
location 3272166 ~ 3272476 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU300145
TTTTTATTGTGTCTTAAAAACGGCGGTTGCTAACAAATTGCTAAAAGGGACTACTTCCTTTGGCGGGGACTTTAGACGTCATCATGACAAACAGGACATTTGGACAGCATTTCTCATGAAAAAGTGGATAAGTATTCATACACAGCGCAGATCATAATCAGCGAGCATGTTTTTAAATAAAGTTGTTTTTTAAATAAAGTTTGAGGAAGCTTGGTGGTGGTGACCTTGATCCGCGACCATGGTGTGCTGTAGTCTGAATATAGCCTACTGTTAGCTTTTTATATCTGACGACTTCATTTAGGCTTCGAAAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU300145 True 311 lncRNA 0.39 1 3272166 3272476

Neighbor

gene id symbol gene type direction distance location
CI01000063_02990060_02990880 NA coding downstream 280699 2988694 ~ 2991467 (-)
CI01000063_02725759_02726399 NA coding downstream 545632 2725759 ~ 2726535 (-)
CI01000063_02707551_02721566 SNF8 coding downstream 550600 2706964 ~ 2721582 (-)
CI01000063_02675583_02681052 NA coding downstream 591114 2674054 ~ 2681052 (-)
CI01000063_02656350_02661590 SLC16A6A coding downstream 610366 2656345 ~ 2661800 (-)
CI01000063_03296061_03306819 EME1 coding upstream 23458 3295934 ~ 3306819 (-)
CI01000063_03373714_03386774 TR-ALPHA, THRAA, THRAB, THRA coding upstream 100567 3373043 ~ 3386774 (-)
CI01000063_03426029_03462400 NA coding upstream 153130 3425606 ~ 3463898 (-)
CI01000063_03615200_03619061 ORMDL2, ORMDL3 coding upstream 342660 3615136 ~ 3620436 (-)
CI01000063_03628232_03633396 NA coding upstream 355601 3628077 ~ 3633446 (-)
G264363 NA non-coding downstream 127999 3143863 ~ 3144167 (-)
G264323 NA non-coding downstream 211852 3060102 ~ 3060314 (-)
G264319 NA non-coding downstream 231093 3040816 ~ 3041073 (-)
G264314 NA non-coding downstream 258020 3013823 ~ 3014146 (-)
G264312 NA non-coding downstream 265896 3002798 ~ 3006270 (-)
G264475 NA non-coding upstream 7430 3279906 ~ 3280122 (-)
G264481 NA non-coding upstream 39769 3312245 ~ 3312469 (-)
G264482 NA non-coding upstream 40076 3312552 ~ 3312768 (-)
G264495 NA non-coding upstream 65750 3338226 ~ 3338521 (-)
G264508 NA non-coding upstream 81817 3354293 ~ 3354756 (-)
CI01000063_02326799_02327290 CBY1 other downstream 944447 2326741 ~ 2327309 (-)
CI01000063_02177769_02178239 NA other downstream 1093830 2177747 ~ 2178395 (-)
CI01000063_01669384_01670016 HBAE1 other downstream 1602090 1669317 ~ 1672019 (-)
G265567 NA other upstream 1890018 5183279 ~ 5183287 (-)
CI01000063_05189361_05189645 CRIPT other upstream 1915927 5188403 ~ 5189645 (-)
CI01000063_05616519_05617045 NA other upstream 2274225 5615806 ~ 5617112 (-)
G265976 NA other upstream 3015682 6283058 ~ 6290946 (-)
G266797 NA other upstream 4017019 7289495 ~ 7290224 (-)

Expression


Co-expression Network