G264532


Basic Information

Item Value
gene id G264532
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000063
NCBI id null
chromosome length 7808773
location 3543455 ~ 3543676 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU300214
TTGGACGCTTGAACATTTTGAGTTTACTCGCTTCATTCGCGCGTGAAATTCAATTCACAACAGACGCGAATTCGCGTCATGAGAGGGGCTTCTGCCAGGCGGCTTGTCTCATTTCTGCACACTTCCTCTGAATAAACACATCAACTCGTCAGCAGAAAGTAGTTGTAAAACACGGCGAATAAGCTCAATTTGCCGGCTTTAGCTAGCTTGTAGTCTCAATAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU300214 True 222 lncRNA 0.45 1 3543455 3543676

Neighbor

gene id symbol gene type direction distance location
CI01000063_03426029_03462400 NA coding downstream 79557 3425606 ~ 3463898 (-)
CI01000063_03373714_03386774 TR-ALPHA, THRAA, THRAB, THRA coding downstream 156681 3373043 ~ 3386774 (-)
CI01000063_03296061_03306819 EME1 coding downstream 236636 3295934 ~ 3306819 (-)
CI01000063_02990060_02990880 NA coding downstream 551988 2988694 ~ 2991467 (-)
CI01000063_02725759_02726399 NA coding downstream 816921 2725759 ~ 2726535 (-)
CI01000063_03615200_03619061 ORMDL2, ORMDL3 coding upstream 71460 3615136 ~ 3620436 (-)
CI01000063_03628232_03633396 NA coding upstream 84401 3628077 ~ 3633446 (-)
CI01000063_03667811_03688065 NSFB, NSF.L, NSFA, NSF coding upstream 123865 3667541 ~ 3688065 (-)
CI01000063_03695944_03716188 NA coding upstream 152268 3695944 ~ 3716188 (-)
CI01000063_03742908_03771506 NEURL4 coding upstream 198940 3742616 ~ 3771506 (-)
G264522 NA non-coding downstream 9212 3534040 ~ 3534243 (-)
G264388 NA non-coding downstream 22066 3427432 ~ 3521389 (-)
G264382 NA non-coding downstream 174929 3367261 ~ 3368526 (-)
G264508 NA non-coding downstream 188699 3354293 ~ 3354756 (-)
G264495 NA non-coding downstream 204934 3338226 ~ 3338521 (-)
G264545 NA non-coding upstream 15867 3559543 ~ 3559788 (-)
G264564 NA non-coding upstream 87483 3631159 ~ 3631379 (-)
G264565 NA non-coding upstream 88617 3632293 ~ 3632514 (-)
G264567 NA non-coding upstream 90772 3634448 ~ 3634747 (-)
CI01000063_02326799_02327290 CBY1 other downstream 1215736 2326741 ~ 2327309 (-)
CI01000063_02177769_02178239 NA other downstream 1365119 2177747 ~ 2178395 (-)
CI01000063_01669384_01670016 HBAE1 other downstream 1873379 1669317 ~ 1672019 (-)
G265567 NA other upstream 1618818 5183279 ~ 5183287 (-)
CI01000063_05189361_05189645 CRIPT other upstream 1644727 5188403 ~ 5189645 (-)
CI01000063_05616519_05617045 NA other upstream 2003025 5615806 ~ 5617112 (-)
G265976 NA other upstream 2744482 6283058 ~ 6290946 (-)
G266797 NA other upstream 3745819 7289495 ~ 7290224 (-)

Expression


Co-expression Network