G264573


Basic Information

Item Value
gene id G264573
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000063
NCBI id null
chromosome length 7808773
location 3639686 ~ 3639891 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU300255
TGTCATCTTGTAGCCTATTGAATGTTATTTGTAGGATAATGTGTATACATTACAGTGCTGTGAACCTACAGCAGTATAGTTCCTGAAATGTTTTTCAAATATTTTGATTCAGAGAGGCTATTCATTTTGATGTTTTTTTGTGTGTGTGTGTGTTTTTTTTTTGGTTTGTTTGTTTGTTTTTGTGTTTTTGTTTGCCTTGCTTTTTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU300255 True 206 lncRNA 0.31 1 3639686 3639891

Neighbor

gene id symbol gene type direction distance location
CI01000063_03628232_03633396 NA coding downstream 6240 3628077 ~ 3633446 (-)
CI01000063_03615200_03619061 ORMDL2, ORMDL3 coding downstream 19250 3615136 ~ 3620436 (-)
CI01000063_03426029_03462400 NA coding downstream 175788 3425606 ~ 3463898 (-)
CI01000063_03373714_03386774 TR-ALPHA, THRAA, THRAB, THRA coding downstream 252912 3373043 ~ 3386774 (-)
CI01000063_03296061_03306819 EME1 coding downstream 332867 3295934 ~ 3306819 (-)
CI01000063_03667811_03688065 NSFB, NSF.L, NSFA, NSF coding upstream 27650 3667541 ~ 3688065 (-)
CI01000063_03695944_03716188 NA coding upstream 56053 3695944 ~ 3716188 (-)
CI01000063_03742908_03771506 NEURL4 coding upstream 102725 3742616 ~ 3771506 (-)
CI01000063_03772788_03776821 SHBG coding upstream 132725 3772616 ~ 3776821 (-)
CI01000063_03784602_03791834 ZBTB4 coding upstream 143703 3783594 ~ 3791834 (-)
G264572 NA non-coding downstream 751 3638698 ~ 3638935 (-)
G264571 NA non-coding downstream 1081 3638332 ~ 3638605 (-)
G264570 NA non-coding downstream 1462 3637996 ~ 3638224 (-)
G264569 NA non-coding downstream 3565 3635889 ~ 3636121 (-)
G264568 NA non-coding downstream 3876 3635524 ~ 3635810 (-)
G264574 NA non-coding upstream 325 3640216 ~ 3640503 (-)
G264575 NA non-coding upstream 1639 3641530 ~ 3641781 (-)
G264576 NA non-coding upstream 2455 3642346 ~ 3642595 (-)
G264577 NA non-coding upstream 3402 3643293 ~ 3643641 (-)
G264579 NA non-coding upstream 4249 3644140 ~ 3644437 (-)
CI01000063_02725759_02726399 NA other downstream 913151 2725759 ~ 2726535 (-)
CI01000063_02326799_02327290 CBY1 other downstream 1311967 2326741 ~ 2327309 (-)
CI01000063_02177769_02178239 NA other downstream 1461350 2177747 ~ 2178395 (-)
CI01000063_01669384_01670016 HBAE1 other downstream 1969610 1669317 ~ 1672019 (-)
G265567 NA other upstream 1522603 5183279 ~ 5183287 (-)
CI01000063_05189361_05189645 CRIPT other upstream 1548512 5188403 ~ 5189645 (-)
CI01000063_05616519_05617045 NA other upstream 1906810 5615806 ~ 5617112 (-)
G265976 NA other upstream 2648267 6283058 ~ 6290946 (-)
G266797 NA other upstream 3649604 7289495 ~ 7290224 (-)

Expression


Co-expression Network