G264593


Basic Information

Item Value
gene id G264593
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000063
NCBI id null
chromosome length 7808773
location 3802051 ~ 3802307 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU300275
CCCTTTCATGGAAACGGTATTCCCTAGTGGCTGTGGCCTCTTTCAGCAGGATGGTTCAGGAATGGTTTGAGGCCTCCAAATTCCCCAGTTCTCAATCCAATCGAGCATCTCTGGGATGTGCTGAACAAACAAGTCCGATCCATGGAGCTCCACCTCACAACTTACAGGACTTAAAGGATCTGCTGCTATCATCTTGGTGCCAGATACCACAGCACACCTTCAGGGGTCTAGTGAAGTCCATGCCTCGACGGGTCAGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU300275 True 257 lncRNA 0.51 1 3802051 3802307

Neighbor

gene id symbol gene type direction distance location
CI01000063_03784602_03791834 ZBTB4 coding downstream 10217 3783594 ~ 3791834 (-)
CI01000063_03772788_03776821 SHBG coding downstream 25230 3772616 ~ 3776821 (-)
CI01000063_03742908_03771506 NEURL4 coding downstream 30545 3742616 ~ 3771506 (-)
CI01000063_03695944_03716188 NA coding downstream 85863 3695944 ~ 3716188 (-)
CI01000063_03667811_03688065 NSFB, NSF.L, NSFA, NSF coding downstream 113986 3667541 ~ 3688065 (-)
CI01000063_03879695_03885921 ZCCHC4 coding upstream 76984 3879291 ~ 3886018 (-)
CI01000063_03894170_03896007 ZCCHC4 coding upstream 91863 3894170 ~ 3896196 (-)
CI01000063_04056574_04087071 MKXA, MKX coding upstream 253889 4056196 ~ 4088615 (-)
CI01000063_04101695_04159421 ARMC4 coding upstream 299095 4101402 ~ 4159421 (-)
CI01000063_04183070_04264881 MPP7A, MPP7 coding upstream 380273 4182580 ~ 4264881 (-)
G264406 NA non-coding downstream 1514 3797223 ~ 3800537 (-)
G264404 NA non-coding downstream 138150 3661599 ~ 3663901 (-)
G264582 NA non-coding downstream 152319 3649494 ~ 3649732 (-)
G264581 NA non-coding downstream 155475 3646365 ~ 3646576 (-)
G264580 NA non-coding downstream 156651 3645165 ~ 3645400 (-)
G264383 NA non-coding upstream 3130 3805437 ~ 3807805 (-)
G264595 NA non-coding upstream 21194 3823501 ~ 3832858 (-)
G264602 NA non-coding upstream 159220 3961527 ~ 3964475 (-)
G264646 NA non-coding upstream 162754 3965061 ~ 3965707 (-)
G264647 NA non-coding upstream 163720 3966027 ~ 3966241 (-)
CI01000063_02725759_02726399 NA other downstream 1075516 2725759 ~ 2726535 (-)
CI01000063_02326799_02327290 CBY1 other downstream 1474332 2326741 ~ 2327309 (-)
CI01000063_02177769_02178239 NA other downstream 1623715 2177747 ~ 2178395 (-)
CI01000063_01669384_01670016 HBAE1 other downstream 2131975 1669317 ~ 1672019 (-)
G265567 NA other upstream 1360187 5183279 ~ 5183287 (-)
CI01000063_05189361_05189645 CRIPT other upstream 1386096 5188403 ~ 5189645 (-)
CI01000063_05616519_05617045 NA other upstream 1744394 5615806 ~ 5617112 (-)
G265976 NA other upstream 2485851 6283058 ~ 6290946 (-)
G266797 NA other upstream 3487188 7289495 ~ 7290224 (-)

Expression


Co-expression Network