G264600


Basic Information

Item Value
gene id G264600
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000063
NCBI id null
chromosome length 7808773
location 3985153 ~ 3985847 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU300284
GAAGTGAGAAGAGCTCGAGGGATGAGAAGATCTTACTCGGGGTGAACGCGGCTCTTTCCAAACCAAAACGGGACTATAAATTACACGTGGACAGAGTAATATTAATCAACGATCTCAAAGCATGCAAATCCACATGGAGATACTGGACACTCACCCCTCGAGGCGAACAGTATGGGGTCGCTCCGCATCTTAAAGTCAAACGCATCTAACTCCGAGTAGGTAGGGGTTGCAGGCGTGTGTCAGACAGCTGCTGTATTTCATTAAAATCCGCGCAACAGAGCCGTCTCTGTTTTCCCCGCTTTCTCTCTGTGTGAACAAGCAGAACTGCACTCGCTGCCGCCAGGCAATGTCTCGTTTCCTCTAAAAACTTGCCCTGACTTTCTCCTCGATCCTGACACAGAGCAGGTCTGTTCACTTTCTGTTTATCGCGATGCGAACAGCAAACCGCTGCGCCTTCGAAAGGGAGCTGCTTGGAGGCTTACAAGAAAATCTTTCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU300284 True 496 lncRNA 0.49 2 3985153 3985847

Neighbor

gene id symbol gene type direction distance location
CI01000063_03894170_03896007 ZCCHC4 coding downstream 88957 3894170 ~ 3896196 (-)
CI01000063_03879695_03885921 ZCCHC4 coding downstream 99135 3879291 ~ 3886018 (-)
CI01000063_03784602_03791834 ZBTB4 coding downstream 193319 3783594 ~ 3791834 (-)
CI01000063_03772788_03776821 SHBG coding downstream 208332 3772616 ~ 3776821 (-)
CI01000063_03742908_03771506 NEURL4 coding downstream 213647 3742616 ~ 3771506 (-)
CI01000063_04056574_04087071 MKXA, MKX coding upstream 70349 4056196 ~ 4088615 (-)
CI01000063_04101695_04159421 ARMC4 coding upstream 115555 4101402 ~ 4159421 (-)
CI01000063_04183070_04264881 MPP7A, MPP7 coding upstream 196733 4182580 ~ 4264881 (-)
CI01000063_04471188_04479927 MAP3K8 coding upstream 484053 4469900 ~ 4479927 (-)
CI01000063_04667829_04669237 CHAC2 coding upstream 681319 4667166 ~ 4669237 (-)
G264647 NA non-coding downstream 18912 3966027 ~ 3966241 (-)
G264646 NA non-coding downstream 19446 3965061 ~ 3965707 (-)
G264602 NA non-coding downstream 20678 3961527 ~ 3964475 (-)
G264595 NA non-coding downstream 152295 3823501 ~ 3832858 (-)
G264383 NA non-coding downstream 177348 3805437 ~ 3807805 (-)
G264673 NA non-coding upstream 50587 4036434 ~ 4036726 (-)
G264610 NA non-coding upstream 51359 4037206 ~ 4038101 (-)
G264675 NA non-coding upstream 57098 4042945 ~ 4043349 (-)
G264677 NA non-coding upstream 60009 4045856 ~ 4046061 (-)
G264728 NA non-coding upstream 171794 4157641 ~ 4158147 (-)
CI01000063_02725759_02726399 NA other downstream 1258618 2725759 ~ 2726535 (-)
CI01000063_02326799_02327290 CBY1 other downstream 1657434 2326741 ~ 2327309 (-)
CI01000063_02177769_02178239 NA other downstream 1806817 2177747 ~ 2178395 (-)
CI01000063_01669384_01670016 HBAE1 other downstream 2315077 1669317 ~ 1672019 (-)
G265567 NA other upstream 1176647 5183279 ~ 5183287 (-)
CI01000063_05189361_05189645 CRIPT other upstream 1202556 5188403 ~ 5189645 (-)
CI01000063_05616519_05617045 NA other upstream 1560854 5615806 ~ 5617112 (-)
G265976 NA other upstream 2302311 6283058 ~ 6290946 (-)
G266797 NA other upstream 3303648 7289495 ~ 7290224 (-)

Expression


Co-expression Network