G264142


Basic Information

Item Value
gene id G264142
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000063
NCBI id null
chromosome length 7808773
location 4345434 ~ 4345721 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU299807
CCTACATCCACTCTCCAGTGCAGACCTGCAGTTTCCACCTCCAGCAGTCTGGGAAACACTGTCAAATGGCTGACAAAGCACTGAAACAAAGTTCTGACTTTAATGCGTTTCTCAAAAAAATCCATATTAATACTACCCTCAGGGACAAACATTAAGATTTTAATGGTTTTGATAGGGTCTTGAAGTCTTGATGATACTATATATTAGGTTTCTATCTTGTAATATGCCACACCAGCTTTCATTTTAATAACCATTATGTTATTATGATTTTTTCTCCTTGCTACCTGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU299807 True 288 lncRNA 0.37 1 4345434 4345721

Neighbor

gene id symbol gene type direction distance location
CI01000063_04310020_04338879 WACA, WAC coding upstream 6416 4310020 ~ 4339018 (+)
CI01000063_04168036_04180451 NA coding upstream 164918 4166544 ~ 4180516 (+)
CI01000063_04026940_04034428 RAB18B, RAB18, RAB18.S, RAB18A coding upstream 310731 4026940 ~ 4034703 (+)
CI01000063_03991410_04022994 AFAP1 coding upstream 321735 3991301 ~ 4023699 (+)
CI01000063_03920353_03956590 ABLIM2 coding upstream 388844 3920353 ~ 3956590 (+)
CI01000063_04345980_04349791 BAMBI, BAMBIA coding downstream 259 4345980 ~ 4350236 (+)
CI01000063_04479946_04487899 MTPAP coding downstream 134103 4479824 ~ 4487907 (+)
CI01000063_04524187_04533040 NA coding downstream 177733 4523454 ~ 4533366 (+)
CI01000063_04544999_04552162 NA coding downstream 198321 4544042 ~ 4552265 (+)
CI01000063_04568412_04568747 NA coding downstream 222563 4568284 ~ 4569210 (+)
G263947 NA non-coding upstream 488365 3856734 ~ 3857069 (+)
G263941 NA non-coding upstream 537635 3805499 ~ 3807799 (+)
G263936 NA non-coding upstream 570946 3772468 ~ 3774488 (+)
G263945 NA non-coding upstream 729967 3609493 ~ 3615467 (+)
G263968 NA non-coding upstream 738485 3606620 ~ 3606949 (+)
G264162 NA non-coding downstream 49147 4394868 ~ 4400467 (+)
G264171 NA non-coding downstream 58151 4403872 ~ 4404343 (+)
G264172 NA non-coding downstream 60311 4406032 ~ 4406271 (+)
G264174 NA non-coding downstream 63967 4409688 ~ 4410067 (+)
G264177 NA non-coding downstream 66432 4412153 ~ 4412491 (+)
G262436 NA other upstream 1630917 2713615 ~ 2714517 (+)
G262423 NA other upstream 2102469 2241408 ~ 2242965 (+)
G262194 NA other upstream 3200427 1139352 ~ 1145007 (+)
G262060 NA other upstream 3634880 710110 ~ 710554 (+)
G261984 NA other upstream 3678052 665800 ~ 667382 (+)
G265391 NA other downstream 1568062 5913783 ~ 5919029 (+)
CI01000063_06335618_06338138 HOXB8B other downstream 1989557 6335618 ~ 6338283 (+)

Expression


Co-expression Network