G264171


Basic Information

Item Value
gene id G264171
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000063
NCBI id null
chromosome length 7808773
location 4403872 ~ 4404343 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU299844
ATGAATTAATGCATATTAATGCACCAGTATTGTAAAGTGTTACCGGTTTATTTTACTGCAAAACAAGGCAGAAATAATGATTAAGAAAATTATTTTTTTTAAATGTGAAGTCTGCACAGTATTCTACAATTGCCAATTTAAATTACTCTTGATATAAAGATATACTGAAATAAGCAGAAAATCTCTCTCAAATTCTTACGCAATTTTGCTTCTTAATTAAATTCTAAAATCTAAACTCTAATTAGCTTCTAATTGTGCTTCTAAATATATCATATAGGCCTAATATATTACATTTATTCTTTTTTAAGGATGTTTATTTTACTGCAAAACGAGAAATACAGCTTAAGAAAATTATATTAAATTATGTGAAATGTGAAATCTGCACAGTATTTTATTAATTATTATTTTTACAATAAAATTAATTTTATAAAGTATTTTTAAAACTTGTTTTTCAACACATTGTCATAAAAGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU299844 True 472 lncRNA 0.23 1 4403872 4404343

Neighbor

gene id symbol gene type direction distance location
CI01000063_04345980_04349791 BAMBI, BAMBIA coding upstream 53636 4345980 ~ 4350236 (+)
CI01000063_04310020_04338879 WACA, WAC coding upstream 64854 4310020 ~ 4339018 (+)
CI01000063_04168036_04180451 NA coding upstream 223356 4166544 ~ 4180516 (+)
CI01000063_04026940_04034428 RAB18B, RAB18, RAB18.S, RAB18A coding upstream 369169 4026940 ~ 4034703 (+)
CI01000063_03991410_04022994 AFAP1 coding upstream 380173 3991301 ~ 4023699 (+)
CI01000063_04479946_04487899 MTPAP coding downstream 75481 4479824 ~ 4487907 (+)
CI01000063_04524187_04533040 NA coding downstream 119111 4523454 ~ 4533366 (+)
CI01000063_04544999_04552162 NA coding downstream 139699 4544042 ~ 4552265 (+)
CI01000063_04568412_04568747 NA coding downstream 163941 4568284 ~ 4569210 (+)
CI01000063_04594405_04629754 SVIL coding downstream 190062 4594405 ~ 4630452 (+)
G264162 NA non-coding upstream 3405 4394868 ~ 4400467 (+)
G264142 NA non-coding upstream 58151 4345434 ~ 4345721 (+)
G263947 NA non-coding upstream 546803 3856734 ~ 3857069 (+)
G263941 NA non-coding upstream 596073 3805499 ~ 3807799 (+)
G263936 NA non-coding upstream 629384 3772468 ~ 3774488 (+)
G264172 NA non-coding downstream 1689 4406032 ~ 4406271 (+)
G264174 NA non-coding downstream 5345 4409688 ~ 4410067 (+)
G264177 NA non-coding downstream 7810 4412153 ~ 4412491 (+)
G264188 NA non-coding downstream 33314 4437657 ~ 4438014 (+)
G264197 NA non-coding downstream 56362 4460705 ~ 4460934 (+)
G262436 NA other upstream 1689355 2713615 ~ 2714517 (+)
G262423 NA other upstream 2160907 2241408 ~ 2242965 (+)
G262194 NA other upstream 3258865 1139352 ~ 1145007 (+)
G262060 NA other upstream 3693318 710110 ~ 710554 (+)
G261984 NA other upstream 3736490 665800 ~ 667382 (+)
G265391 NA other downstream 1509440 5913783 ~ 5919029 (+)
CI01000063_06335618_06338138 HOXB8B other downstream 1930935 6335618 ~ 6338283 (+)

Expression


Co-expression Network