G265109


Basic Information

Item Value
gene id G265109
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000063
NCBI id null
chromosome length 7808773
location 5319632 ~ 5319863 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU300875
CTTGTACATTGTAATCACTGCATTGGGAACTCCCCGTGCTTCTGCAACAGAACATTTGTTTCCTCTGGGACAAATATGAGATCTGTTGAGGCTGCTGTGGCATGTGCGTAGCTGGGTTGACCCTGCACTGAGTATGTTCCCCCATTAGTCCTATTTTTAGTTAGCGGTAGTCGTATAATGTACAGACATACAGCTTGGCCATATCCCTGGGTATGGTTGGATCCAAAAAAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU300875 True 232 lncRNA 0.45 1 5319632 5319863

Neighbor

gene id symbol gene type direction distance location
CI01000063_05281800_05302429 NA coding upstream 17133 5280655 ~ 5302499 (+)
CI01000063_05271158_05276999 NA coding upstream 42527 5271158 ~ 5277105 (+)
CI01000063_05223875_05227171 NA coding upstream 92461 5223875 ~ 5227171 (+)
CI01000063_05191319_05197432 PIGF coding upstream 122072 5191319 ~ 5197560 (+)
CI01000063_05183819_05187667 GCH2, GCH1 coding upstream 131283 5183619 ~ 5188349 (+)
CI01000063_05400578_05406105 PPM1BB, PPM1B coding downstream 80715 5400578 ~ 5406277 (+)
CI01000063_05466326_05468126 SIX3, SIX3A, SIX3B, SIX3.L coding downstream 146189 5466052 ~ 5469282 (+)
CI01000063_05490285_05556254 PRKCEA, PRKCE, PRKCEB coding downstream 170422 5490285 ~ 5556462 (+)
CI01000063_05563124_05584474 NA coding downstream 243261 5563124 ~ 5585104 (+)
CI01000063_05597755_05613489 GDH1, GLUD1B, GLUD1A, GDH2, GDH3.2, GLUD1, GDH03, GDH01, GLUD1.S coding downstream 277461 5597324 ~ 5614654 (+)
G265104 NA non-coding upstream 5121 5314229 ~ 5314511 (+)
G265096 NA non-coding upstream 11338 5307945 ~ 5308294 (+)
G265046 NA non-coding upstream 160216 5155129 ~ 5159416 (+)
G265059 NA non-coding upstream 164915 5154191 ~ 5154717 (+)
G265058 NA non-coding upstream 165458 5153835 ~ 5154174 (+)
G265114 NA non-coding downstream 6140 5326003 ~ 5326336 (+)
G265126 NA non-coding downstream 22351 5342214 ~ 5342446 (+)
G265132 NA non-coding downstream 29898 5349761 ~ 5349978 (+)
G265133 NA non-coding downstream 30643 5350506 ~ 5350913 (+)
G265094 NA non-coding downstream 41071 5360934 ~ 5367266 (+)
G262436 NA other upstream 2605115 2713615 ~ 2714517 (+)
G262423 NA other upstream 3076667 2241408 ~ 2242965 (+)
G262194 NA other upstream 4174625 1139352 ~ 1145007 (+)
G262060 NA other upstream 4609078 710110 ~ 710554 (+)
G261984 NA other upstream 4652250 665800 ~ 667382 (+)
G265391 NA other downstream 593920 5913783 ~ 5919029 (+)
CI01000063_06335618_06338138 HOXB8B other downstream 1015415 6335618 ~ 6338283 (+)

Expression


Co-expression Network