G266006


Basic Information

Item Value
gene id G266006
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000063
NCBI id null
chromosome length 7808773
location 6259466 ~ 6259691 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU301912
GTATTGGCTCCATAAGCTCAGCTGCTGCTTTCTATTTCCACAGAATGACCTTGGTGGGTGCATGGGGTGTAGAAGGGGATAACACAGGGGCTCATGATTTTTGTGAGTAGCCTATCATATCAAAAGCCAGTTAAACTCAATTTATCCACACTTTCTGTTACATTAATATAGTTACATCACTTCTGGAAGCATTTTAAATACTTTAAAGAACTACTGCAGAAAGAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU301912 True 226 lncRNA 0.38 1 6259466 6259691

Neighbor

gene id symbol gene type direction distance location
CI01000063_06110909_06118565 NA coding downstream 139547 6110909 ~ 6119919 (-)
CI01000063_06018383_06022776 NA coding downstream 235979 6018083 ~ 6023487 (-)
CI01000063_06011344_06017382 KCTD2 coding downstream 242084 6010663 ~ 6017382 (-)
CI01000063_05992697_06005239 SLC16A5A, SLC16A5 coding downstream 254107 5992579 ~ 6005359 (-)
CI01000063_05983940_05990611 NA coding downstream 268855 5983455 ~ 5990611 (-)
CI01000063_06271330_06273137 CHM2A, CHMP2A, BRAFLDRAFT_115689, BC2, CHMP2A.L coding upstream 11072 6270763 ~ 6273137 (-)
CI01000063_06291489_06291799 NA coding upstream 31523 6291214 ~ 6291799 (-)
CI01000063_06332215_06332433 NA coding upstream 72458 6332149 ~ 6332433 (-)
CI01000063_06404520_06407506 PSME3 coding upstream 144133 6403824 ~ 6407676 (-)
CI01000063_06652744_06663333 DHX8 coding upstream 392445 6652136 ~ 6663590 (-)
G266005 NA non-coding downstream 69 6259195 ~ 6259397 (-)
G266003 NA non-coding downstream 2751 6255577 ~ 6256715 (-)
G266002 NA non-coding downstream 4243 6255024 ~ 6255223 (-)
G265960 NA non-coding downstream 24087 6202965 ~ 6235379 (-)
G265776 NA non-coding downstream 70802 6185934 ~ 6188664 (-)
G265976 NA non-coding upstream 23367 6283058 ~ 6290946 (-)
G265985 NA non-coding upstream 44792 6304483 ~ 6304949 (-)
G266016 NA non-coding upstream 59870 6319561 ~ 6319837 (-)
G266017 NA non-coding upstream 60547 6320238 ~ 6320628 (-)
G266018 NA non-coding upstream 61208 6320899 ~ 6321186 (-)
CI01000063_05616519_05617045 NA other downstream 642354 5615806 ~ 5617112 (-)
G265567 NA other downstream 1005526 5183279 ~ 5183287 (-)
CI01000063_05189361_05189645 CRIPT other downstream 1068849 5188403 ~ 5189645 (-)
CI01000063_02725759_02726399 NA other downstream 3532931 2725759 ~ 2726535 (-)
CI01000063_02326799_02327290 CBY1 other downstream 3931747 2326741 ~ 2327309 (-)
G266797 NA other upstream 1029804 7289495 ~ 7290224 (-)
G266660 NA other upstream 1179394 7439085 ~ 7441435 (-)

Expression


Co-expression Network