G266482


Basic Information

Item Value
gene id G266482
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000063
NCBI id null
chromosome length 7808773
location 6619864 ~ 6620181 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU302462
GGAAAGTCGAGGAAGGAAAAATGCCATTCATAAAAACTTGCCCCAGCAGGAATGTTTTATGGTTGTTTTCAGCGTTTGCCTGTATTAACAACAGATACAGCTTGCGAAAACATCACGTGGTAGCTGCTGGGCTCGGAACAACAGTGGATGGTTGCAATCTCAAAAGTGTATAAGTGAGTGTACTGTCTGGCAGCAAAATCCGCAAACAGCGACACACACTTTCCATTATAAATCAGAATTACCTGTGCAAAACAATGACGTTCTCTAGTAAATTAAACTTCTTGTAAACAGCGTTTTAGAAGTTACTTACAGCCTACT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU302462 True 318 lncRNA 0.41 1 6619864 6620181

Neighbor

gene id symbol gene type direction distance location
CI01000063_06404520_06407506 PSME3 coding downstream 212188 6403824 ~ 6407676 (-)
CI01000063_06332215_06332433 NA coding downstream 287431 6332149 ~ 6332433 (-)
CI01000063_06291489_06291799 NA coding downstream 328065 6291214 ~ 6291799 (-)
CI01000063_06271330_06273137 CHM2A, CHMP2A, BRAFLDRAFT_115689, BC2, CHMP2A.L coding downstream 346727 6270763 ~ 6273137 (-)
CI01000063_06110909_06118565 NA coding downstream 499945 6110909 ~ 6119919 (-)
CI01000063_06652744_06663333 DHX8 coding upstream 31955 6652136 ~ 6663590 (-)
CI01000063_07092189_07106801 OGFOD3 coding upstream 471909 7092090 ~ 7107755 (-)
CI01000063_07114269_07117313 PSMD11 coding upstream 493226 7113407 ~ 7117798 (-)
CI01000063_07147043_07192035 MYO1D coding upstream 525825 7146006 ~ 7192035 (-)
CI01000063_07205887_07209986 NA coding upstream 585674 7205855 ~ 7210671 (-)
G266136 NA non-coding downstream 25766 6573224 ~ 6594098 (-)
G266103 NA non-coding downstream 53095 6483179 ~ 6566769 (-)
G266084 NA non-coding downstream 138657 6480264 ~ 6481207 (-)
G266074 NA non-coding downstream 167981 6451600 ~ 6451883 (-)
G266057 NA non-coding downstream 192096 6425935 ~ 6427768 (-)
G266497 NA non-coding upstream 46148 6666329 ~ 6668289 (-)
G266498 NA non-coding upstream 49211 6669392 ~ 6711149 (-)
G266641 NA non-coding upstream 308665 6928846 ~ 6929326 (-)
G266642 NA non-coding upstream 311896 6932077 ~ 6932424 (-)
G266722 NA non-coding upstream 404211 7024392 ~ 7024605 (-)
G265976 NA other downstream 328918 6283058 ~ 6290946 (-)
CI01000063_05616519_05617045 NA other downstream 1002752 5615806 ~ 5617112 (-)
G265567 NA other downstream 1365924 5183279 ~ 5183287 (-)
CI01000063_05189361_05189645 CRIPT other downstream 1429247 5188403 ~ 5189645 (-)
CI01000063_02725759_02726399 NA other downstream 3893329 2725759 ~ 2726535 (-)
G266797 NA other upstream 669314 7289495 ~ 7290224 (-)
G266660 NA other upstream 818904 7439085 ~ 7441435 (-)

Expression


Co-expression Network