CI01000065_00873636_00877487 (ATG5)


Basic Information

Item Value
gene id CI01000065_00873636_00877487
gene name ATG5
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000065
NCBI id null
chromosome length 4956624
location 873636 ~ 877487 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000065_00873636_00877487.mRNA
CTCAGAAACTGAAGCCCTTGTATGTTCCACCTGGAGAAAGAGGATCATGGCAGATGACAAGGATGTGCTCCGAGATGTTTGGTTCGGAAGGATCCCGGCCTGCTTCACTCTCTCTCCAGAGGAAACCACGGAGAGAGAAGCAGAGCCCTACTATCTGCTCCTCCCACGTGTCAGTTACTTGACGCTTGTCACTGATAAAGTCAAGAAGCATTTCCTCAAAGTCATGAAGGCCGAAGACGTGGAGGAGATGTGGTTTGAGTATGAGGGAACGCCTCTCAAATGGCACTATCCCATTGGCGTGTTGTTTGACCTCCACGCTTCAAACACGGCTCTGCCCTGGAACGTCTCAGTGCACTTTAAGAACTTCCCAGAACAAGACTTGCTTCACTGCCCGTCGAACTCTGTGATAGAAGCACATTTCATGTCGTGCATTAAAGAGGCTGATGCGCTCAAACACAAAAGCCAGGTCATCAACGACATGCAGAAAAAAGACCATAAACAGCTGTGGATGGGTCTGCAGAACGATAAATTCGACCAGTTCTGGGCCATGAATCGGAAACTCATGGAGTATCCGAGTGAAGAGGGCGGCTTCCGCTATATTCCCTTTAGAATATATCAG

Function

symbol description
atg5 Acts upstream of or within several processes, including autophagosome assembly; heart development; and regulation of skeletal muscle tissue regeneration. Predicted to be located in cytoplasm and membrane. Predicted to be part of Atg12-Atg5-Atg16 complex. Predicted to be active in phagophore assembly site membrane. Is expressed in several structures, including central nervous system; head; liver; male organism; and tail bud. Human ortholog(s) of this gene implicated in autosomal recessive spinocerebellar ataxia 25. Orthologous to human ATG5 (autophagy related 5).

GO:

id name namespace
GO:0055015 ventricular cardiac muscle cell development biological_process

KEGG:

id description
K08339 ATG5; autophagy-related protein 5

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000065_00873636_00877487.mRNA True 619 mRNA 0.49 5 873636 877487

Neighbor

gene id symbol gene type direction distance location
CI01000065_00800809_00808759 SRI coding upstream 64762 799876 ~ 808874 (+)
CI01000065_00750437_00764088 BMPER coding upstream 109339 750437 ~ 764297 (+)
CI01000065_00633526_00695106 BBS9 coding upstream 178530 633526 ~ 695106 (+)
CI01000065_00625575_00629127 EAF1 coding upstream 244342 625575 ~ 629294 (+)
CI01000065_00605004_00618190 ARHGEF2 coding upstream 254512 604411 ~ 619124 (+)
CI01000065_01076737_01078446 NA coding downstream 199250 1076737 ~ 1079588 (+)
CI01000065_01452148_01608735 GRIK2 coding downstream 574661 1452148 ~ 1608735 (+)
CI01000065_01867964_01868983 NA coding downstream 990301 1867788 ~ 1869813 (+)
CI01000065_01938179_01949512 NA coding downstream 1060598 1938085 ~ 1950751 (+)
CI01000065_02222213_02282352 NA coding downstream 1344542 2222029 ~ 2282432 (+)
G267457 NA non-coding upstream 242192 631236 ~ 631444 (+)
G267455 NA non-coding upstream 281753 591522 ~ 591883 (+)
G267454 NA non-coding upstream 282417 591015 ~ 591219 (+)
G267441 NA non-coding upstream 361504 511690 ~ 512132 (+)
G267438 NA non-coding upstream 365223 508182 ~ 508413 (+)
G267550 NA non-coding downstream 114795 992282 ~ 992724 (+)
G267551 NA non-coding downstream 118395 995882 ~ 996173 (+)
G267557 NA non-coding downstream 140363 1017850 ~ 1031776 (+)
G267565 NA non-coding downstream 164977 1042464 ~ 1042870 (+)
G267573 NA non-coding downstream 192344 1069831 ~ 1070218 (+)
G267432 NA other upstream 90757 782283 ~ 782879 (+)
G266932 NA other upstream 828970 43038 ~ 44666 (+)
G267577 NA other downstream 204666 1082153 ~ 1082655 (+)
G268525 NA other downstream 1361672 2239159 ~ 2239998 (+)
G268805 NA other downstream 1731420 2608907 ~ 2638205 (+)
G269181 NA other downstream 2581470 3458957 ~ 3462928 (+)
G269225 NA other downstream 2675317 3552804 ~ 3553214 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_009680 atg5 coding NC_007127.7 CM002900.2 7380463 ~ 7416532 (+)