CI01000065_04520939_04539169 (ELOVL4, ELOVL4A)


Basic Information

Item Value
gene id CI01000065_04520939_04539169
gene name ELOVL4, ELOVL4A
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000065
NCBI id null
chromosome length 4956624
location 4520848 ~ 4539261 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000065_04520939_04539169.mRNA
GTATTAAAGCATGGCCACATGGTGTTTTTTACCACTGCACCAACATATCTTTCTTCTGTGTTCTCAGACCATTAAGATTTGAGTCTCAGCGATGGATATTTTAAAGCATATAATCAACGACACTGTGGAGTTCTACAGATGGAGTCTCACTATTGCAGACAAGCGTGTGGAGAAATGGCCTTTGATGGACTCTCCTCTGCCCACGCTGGCTATCAGCTCCTCATACCTGCTGTTCCTCTGGCTGGGGCCGAAGTTCATGCAGGGCCGAGAGCCCTTCCAGCTGAGGAAGACCCTCATCGTCTACAACTTCAGCATGGTCATCCTCAACTTTTTCATTTTCAAAGAGCTCTTCCTTGCAGCACGGGCGGCCAACTACAGCTACATCTGCCAGCCCGTCGACTACTCAGATGATCCTAATGAAGTGAGGGTGGCAGCAGCCTTGTGGTGGTATTTTATTTCTAAAGGTGTGGAGTACCTCGACACTGTGTTTTTCATCTTGCGTAAGAAGTTCAACCATATCAGCTTCCTGCATGTCTATCACCACTGCACCATGTTCACTCTGTGGTGGATTGGCATCAAATGGGTCGCCGGTGGACAGTCATTCTTCGGGGCTCATATGAACGCAGCCATCCATGTCTTGATGTACTTATATTATGGGCTGGCCGCATTTGGTCCGAAAATACAGAAATATCTGTGGTGGAAGAAATATCTGACAATCATCCAAATGATCCAGTTTCACGTCACCATTGGCCACACGGCTTTGTCGCTGTACTCTGACTGCCCGTTCCCGAAGTGGATGCACTGGTGTCTGATTGGATACGCCCTCACCTTCATCATCCTCTTCGGCAATTTCTATTACCAGACGTACCGTCGACAGCCCCGCCGTGAGGCCGCGTCCAAACCCGGCAAAGCCCTTCATAACGGAGCCTCTAATGGAGCCCTGATCTCTAGTAATGGAAACGCTGCCAAGATGGACGAGAAGCCGGCAGTGGCCGATTCAGACCAATACCGATCATTTAAAACCTGGACTGATATCATACATCCTTATGAATACTTTTTGATATCACAGGGTTATCATCAAACATCTCACAATATAAGATAGCTTTTAGTTTTCATTGGGAAATAACAACATCACATAAGCTGAAAATGGGATTGGGAAATATGTTTGTAGCTGCAATATTGCATTGTGCGTAA

Function

symbol description
elovl4a Predicted to enable fatty acid elongase activity. Acts upstream of or within very long-chain fatty acid biosynthetic process. Predicted to be located in endoplasmic reticulum and membrane. Predicted to be integral component of membrane. Predicted to be integral component of endoplasmic reticulum membrane. Is expressed in several structures, including liver; nervous system; neural rod; pleuroperitoneal region; and trigeminal placode. Human ortholog(s) of this gene implicated in corneal dystrophy and spinocerebellar ataxia type 34. Orthologous to human ELOVL4 (ELOVL fatty acid elongase 4).
elovl4 Predicted to enable fatty acid elongase activity. Involved in fatty acid elongation, saturated fatty acid and very long-chain fatty acid biosynthetic process. Located in endoplasmic reticulum. Is integral component of endoplasmic reticulum membrane. Implicated in corneal dystrophy and spinocerebellar ataxia type 34.

GO:

id name namespace
GO:0006633 fatty acid biosynthetic process biological_process

KEGG:

id description
K10249 ELOVL4; elongation of very long chain fatty acids protein 4

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000065_04520939_04539169.mRNA True 1194 mRNA 0.47 7 4520848 4539261

Neighbor

gene id symbol gene type direction distance location
CI01000065_04361047_04363753 NA coding upstream 157009 4360937 ~ 4363839 (+)
CI01000065_04277095_04282609 NA coding upstream 237649 4276008 ~ 4283199 (+)
CI01000065_04247989_04251347 FAM46A.L, FAM46AB, FAM46A, FAM46AA coding upstream 269051 4245663 ~ 4251797 (+)
CI01000065_04183838_04222038 NA coding upstream 298381 4183838 ~ 4222467 (+)
CI01000065_04115052_04165049 NA coding upstream 355419 4112278 ~ 4165429 (+)
CI01000065_04547859_04555579 SOGA3 coding downstream 8598 4547859 ~ 4555579 (+)
CI01000065_04561164_04574594 NA coding downstream 21857 4561118 ~ 4574656 (+)
CI01000065_04578385_04586426 ECHDC1 coding downstream 38579 4577840 ~ 4586454 (+)
CI01000065_04672707_04680741 NA coding downstream 133378 4672639 ~ 4681582 (+)
CI01000065_04684547_04687726 NA coding downstream 144159 4683420 ~ 4687726 (+)
G270062 NA non-coding upstream 8240 4502213 ~ 4512608 (+)
G269999 NA non-coding upstream 15729 4500293 ~ 4505119 (+)
G269967 NA non-coding upstream 141346 4376057 ~ 4379502 (+)
G269966 NA non-coding upstream 149654 4370806 ~ 4371194 (+)
G269965 NA non-coding upstream 150085 4370496 ~ 4370763 (+)
G270090 NA non-coding downstream 170748 4710009 ~ 4714110 (+)
G270054 NA non-coding downstream 243608 4782869 ~ 4784552 (+)
G270098 NA non-coding downstream 285526 4824787 ~ 4825329 (+)
G270100 NA non-coding downstream 289399 4828660 ~ 4828880 (+)
G270036 NA non-coding downstream 329211 4868472 ~ 4870254 (+)
G269225 NA other upstream 967724 3552804 ~ 3553214 (+)
G269181 NA other upstream 1057920 3458957 ~ 3462928 (+)
G268805 NA other upstream 1882643 2608907 ~ 2638205 (+)
G268525 NA other upstream 2280850 2239159 ~ 2239998 (+)
G267577 NA other upstream 3438193 1082153 ~ 1082655 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_009656 elovl4a coding NC_007127.7 CM002900.2 5156420 ~ 5167280 (+)