G267075


Basic Information

Item Value
gene id G267075
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000065
NCBI id null
chromosome length 4956624
location 190479 ~ 190688 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU303121
CTCTAGCTTTGATCTAAATCCCTAGGACAACACATTAGCATTTCACTAGCCTGTTAACTTGTCATCTGTGCTTACCCTCTTTTATCTCTTGCATACTCCTTTTTCTACACGTCCATTAAACAAGTGTGGTAAGCCGGAATCAGTCAACAAACATGGTGAGTCATGTCATCTTCTCCTGTTATTGTCACTTGCACTGCCTATCACATGTTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU303121 True 210 lncRNA 0.40 1 190479 190688

Neighbor

gene id symbol gene type direction distance location
CI01000065_00008351_00023809 NA coding upstream 166141 8351 ~ 24338 (+)
CI01000065_00001128_00004874 NA coding upstream 185295 1128 ~ 5184 (+)
CI01000065_00268067_00268655 NA coding downstream 77379 268067 ~ 268788 (+)
CI01000065_00390457_00395371 SALL3, SALL3A coding downstream 199769 390457 ~ 396151 (+)
CI01000065_00408239_00434714 NA coding downstream 217460 408148 ~ 435407 (+)
CI01000065_00466096_00487259 NA coding downstream 275288 465976 ~ 487278 (+)
CI01000065_00491304_00503042 NA coding downstream 300460 491148 ~ 503458 (+)
G267060 NA non-coding upstream 35667 154606 ~ 154812 (+)
G267055 NA non-coding upstream 47684 142515 ~ 142795 (+)
G266981 NA non-coding upstream 49039 130050 ~ 141440 (+)
G266980 NA non-coding upstream 73407 116324 ~ 117072 (+)
G266929 NA non-coding upstream 98832 76674 ~ 91647 (+)
G267081 NA non-coding downstream 6004 196692 ~ 197028 (+)
G267085 NA non-coding downstream 9796 200484 ~ 200722 (+)
G267087 NA non-coding downstream 11764 202452 ~ 202692 (+)
G267143 NA non-coding downstream 82793 273481 ~ 273912 (+)
G267158 NA non-coding downstream 93211 283899 ~ 284242 (+)
G266932 NA other upstream 145813 43038 ~ 44666 (+)
G267432 NA other downstream 591595 782283 ~ 782879 (+)
G267577 NA other downstream 891465 1082153 ~ 1082655 (+)
G268525 NA other downstream 2048471 2239159 ~ 2239998 (+)
G268805 NA other downstream 2418219 2608907 ~ 2638205 (+)
G269181 NA other downstream 3268269 3458957 ~ 3462928 (+)

Expression


Co-expression Network