G267190


Basic Information

Item Value
gene id G267190
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000065
NCBI id null
chromosome length 4956624
location 309626 ~ 309886 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU303239
NNNCCAACGTTTACCATCCAACCTGACAGAACTGGAGAGGATCTGCAAGGAGGAATGGCAGAGGATCCCCAAATCCAGGTGTGAAAAACTTGTTGCATCTTTCCCAAAAAGATTCATGGCTGTATTAGATCAAAAGGGTGCTTCTACTAAATACTGAGCAAAGGGTCTGAATACTTAGGACCATGTGATATTTCAGTTTTTCTTTTTTAATAAATCTGCAAAAATGTCAACAATTCTGTGTTTTTCTGTCAATATGGGGTG

Function

NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU303239 True 261 lncRNA 0.39 1 309626 309886

Neighbor

gene id symbol gene type direction distance location
CI01000065_00253168_00255665 NA coding downstream 53916 252691 ~ 255710 (-)
CI01000065_00120723_00133111 MBOAT1 coding downstream 176515 120406 ~ 133111 (-)
CI01000065_00097164_00097583 NA coding downstream 212036 96904 ~ 97590 (-)
CI01000065_00076766_00091631 NA coding downstream 217995 76685 ~ 91631 (-)
CI01000065_00050903_00055774 NA coding downstream 253852 50386 ~ 55774 (-)
CI01000065_00330696_00340165 NA coding upstream 20706 330592 ~ 340772 (-)
CI01000065_00444905_00447425 NA coding upstream 134794 444680 ~ 447425 (-)
CI01000065_00563411_00579174 MBPB, MBP coding upstream 252962 562848 ~ 580083 (-)
CI01000065_00622545_00624625 NA coding upstream 312237 622123 ~ 624657 (-)
CI01000065_00768127_00769942 NA coding upstream 457686 767572 ~ 770151 (-)
G267175 NA non-coding downstream 12448 296948 ~ 297178 (-)
G267159 NA non-coding downstream 25527 283872 ~ 284099 (-)
G267140 NA non-coding downstream 38767 270611 ~ 270859 (-)
G267136 NA non-coding downstream 42238 267158 ~ 267388 (-)
G267129 NA non-coding downstream 48028 261362 ~ 261598 (-)
G267205 NA non-coding upstream 15837 325723 ~ 326214 (-)
G267208 NA non-coding upstream 19082 328968 ~ 329192 (-)
G267212 NA non-coding upstream 21463 331349 ~ 331571 (-)
G267273 NA non-coding upstream 89056 398942 ~ 399159 (-)
G267292 NA non-coding upstream 101383 411269 ~ 412146 (-)
G267024 NA other downstream 263539 43039 ~ 46087 (-)
CI01000065_00782736_00793467 NT5C3A, NT5C3 other upstream 472811 782697 ~ 793467 (-)
G269348 NA other upstream 2998557 3304357 ~ 3312480 (-)
G269679 NA other upstream 3463994 3773880 ~ 3774294 (-)

Expression


Co-expression Network