G267722



Basic Information


Item Value
gene id G267722
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000065
NCBI id null
chromosome length 4956624
location 512513 ~ 512750 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU303802
ATGCAAGTAGAGCTCCTATCTCTTTGAATGGGGAAACATCAAATTCTCCAAAATTAAATTTTATATTTGAAATCACCAATGAAATCTGACAACAACTGTCTCATAAATTTTGTTTCTAAATGCTCAAATCATGAGAAAGAACTGCATTTTACAGGCTGGAGTAGCCAATGCACATGTGCAGTCATAAGCGCACGTCTCAGAACACTGACTGTTTCTATAGACCTTATGTAGCCCCGCC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU303802 True 238 lncRNA 0.38 1 512513 512750

Neighbor


gene id symbol gene type direction distance location
CI01000065_00444905_00447425 NA coding downstream 65088 444680 ~ 447425 (-)
CI01000065_00330696_00340165 NA coding downstream 171741 330592 ~ 340772 (-)
CI01000065_00253168_00255665 NA coding downstream 256803 252691 ~ 255710 (-)
CI01000065_00120723_00133111 MBOAT1 coding downstream 379402 120406 ~ 133111 (-)
CI01000065_00097164_00097583 NA coding downstream 414923 96904 ~ 97590 (-)
CI01000065_00563411_00579174 MBPB, MBP coding upstream 50098 562848 ~ 580083 (-)
CI01000065_00622545_00624625 NA coding upstream 109373 622123 ~ 624657 (-)
CI01000065_00768127_00769942 NA coding upstream 254822 767572 ~ 770151 (-)
CI01000065_00782736_00793467 NT5C3A, NT5C3 coding upstream 269986 782697 ~ 793467 (-)
CI01000065_00843437_00865598 FOXO3, FOXO6 coding upstream 330682 843432 ~ 865598 (-)
G267721 NA non-coding downstream 345 511694 ~ 512168 (-)
G267411 NA non-coding downstream 8032 504275 ~ 504481 (-)
G267339 NA non-coding downstream 74950 437334 ~ 437563 (-)
G267310 NA non-coding downstream 91353 420939 ~ 421160 (-)
G267294 NA non-coding downstream 99383 412902 ~ 413130 (-)
G267728 NA non-coding upstream 12129 524879 ~ 525584 (-)
G267739 NA non-coding upstream 35250 548000 ~ 549479 (-)
G267770 NA non-coding upstream 78792 591542 ~ 591749 (-)
G267771 NA non-coding upstream 81872 594622 ~ 598770 (-)
G267778 NA non-coding upstream 117454 630204 ~ 630439 (-)
CI01000065_00050903_00055774 NA other downstream 458126 50386 ~ 55774 (-)
G267024 NA other downstream 466426 43039 ~ 46087 (-)
G269348 NA other upstream 2795693 3304357 ~ 3312480 (-)
G269679 NA other upstream 3261130 3773880 ~ 3774294 (-)

Expression



Co-expression Network