G268301


Basic Information

Item Value
gene id G268301
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000065
NCBI id null
chromosome length 4956624
location 1975511 ~ 1982735 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU304446
ACTGAAAATTAGCCAAGAACTGGGGGATCCTCTGAGTGCGCGCGACTGATGGCGAAAATTCGCCTGTATGGTGTCTATGGAGCCCCTAAAGGGACATGCCATGATGATGATCAAAAAAGAAAAAAGAAAAAAAGAAAAAAAAAAGGTCTCTTGTACCATCAGCTCAAACATGACCTAAGAGACACATCACCGGCTTTGGACTCTTGTCATCACGGTTTACAGTTCCCCATTTCCCTTTTTACCGGTCTGTCGTTATCATATCCGATTGAACAGGGTCAATGGAAAAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU304446 True 287 lncRNA 0.43 3 1975511 1982735

Neighbor

gene id symbol gene type direction distance location
CI01000065_01938179_01949512 NA coding upstream 24760 1938085 ~ 1950751 (+)
CI01000065_01867964_01868983 NA coding upstream 105698 1867788 ~ 1869813 (+)
CI01000065_01452148_01608735 GRIK2 coding upstream 366776 1452148 ~ 1608735 (+)
CI01000065_01076737_01078446 NA coding upstream 895923 1076737 ~ 1079588 (+)
CI01000065_00873636_00877487 ATG5 coding upstream 1098024 873636 ~ 877487 (+)
CI01000065_02222213_02282352 NA coding downstream 239294 2222029 ~ 2282432 (+)
CI01000065_02442834_02444552 NA coding downstream 458924 2441659 ~ 2445951 (+)
CI01000065_02562189_02562709 NA coding downstream 579454 2562189 ~ 2562738 (+)
CI01000065_02714893_02755256 NA coding downstream 730706 2713441 ~ 2755370 (+)
CI01000065_02770419_02775297 NA coding downstream 787314 2770049 ~ 2776165 (+)
G268270 NA non-coding upstream 922 1972364 ~ 1974589 (+)
G268274 NA non-coding upstream 14631 1956365 ~ 1960880 (+)
G268256 NA non-coding upstream 143877 1831429 ~ 1831634 (+)
G268222 NA non-coding upstream 196226 1776226 ~ 1779285 (+)
G268083 NA non-coding upstream 275558 1698719 ~ 1699953 (+)
G268361 NA non-coding downstream 18336 2001071 ~ 2001301 (+)
G268367 NA non-coding downstream 24305 2007040 ~ 2007290 (+)
G268374 NA non-coding downstream 29804 2012539 ~ 2012950 (+)
G268392 NA non-coding downstream 51803 2034538 ~ 2034741 (+)
G268396 NA non-coding downstream 59222 2041957 ~ 2042232 (+)
G267577 NA other upstream 892856 1082153 ~ 1082655 (+)
G267432 NA other upstream 1192632 782283 ~ 782879 (+)
G266932 NA other upstream 1930845 43038 ~ 44666 (+)
G268525 NA other downstream 256424 2239159 ~ 2239998 (+)
G268805 NA other downstream 626172 2608907 ~ 2638205 (+)
G269181 NA other downstream 1476222 3458957 ~ 3462928 (+)
G269225 NA other downstream 1570069 3552804 ~ 3553214 (+)

Expression


Co-expression Network