G268502


Basic Information

Item Value
gene id G268502
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000065
NCBI id null
chromosome length 4956624
location 2150748 ~ 2150948 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU304653
ACTAAACTAACAAACACAAACATACCATTCACACAGTGAGAGAGTGAAAAATGAATTTGAACCGTATCACAACAGGGGAATGAAACAATGTAAAGGGTAAATTAACAATTGCTGGACGAACCATCAGTTTCAATACTATAAAGCACCTTTGTTAAATCTTAAATCAATCTTAATACTAAATTGCCATTTAGTGTTCAAATT

Function

NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU304653 True 201 lncRNA 0.31 1 2150748 2150948

Neighbor

gene id symbol gene type direction distance location
CI01000065_01938179_01949512 NA coding upstream 199997 1938085 ~ 1950751 (+)
CI01000065_01867964_01868983 NA coding upstream 280935 1867788 ~ 1869813 (+)
CI01000065_01452148_01608735 GRIK2 coding upstream 542013 1452148 ~ 1608735 (+)
CI01000065_01076737_01078446 NA coding upstream 1071160 1076737 ~ 1079588 (+)
CI01000065_00873636_00877487 ATG5 coding upstream 1273261 873636 ~ 877487 (+)
CI01000065_02222213_02282352 NA coding downstream 71081 2222029 ~ 2282432 (+)
CI01000065_02442834_02444552 NA coding downstream 290711 2441659 ~ 2445951 (+)
CI01000065_02562189_02562709 NA coding downstream 411241 2562189 ~ 2562738 (+)
CI01000065_02714893_02755256 NA coding downstream 562493 2713441 ~ 2755370 (+)
CI01000065_02770419_02775297 NA coding downstream 619101 2770049 ~ 2776165 (+)
G268472 NA non-coding upstream 59638 2090845 ~ 2091110 (+)
G268469 NA non-coding upstream 60758 2089448 ~ 2089990 (+)
G268468 NA non-coding upstream 61353 2089035 ~ 2089395 (+)
G268466 NA non-coding upstream 62512 2087947 ~ 2088236 (+)
G268396 NA non-coding upstream 108516 2041957 ~ 2042232 (+)
G268576 NA non-coding downstream 246249 2397197 ~ 2397707 (+)
G268603 NA non-coding downstream 313835 2464783 ~ 2530305 (+)
G268635 NA non-coding downstream 386196 2537144 ~ 2537375 (+)
G268638 NA non-coding downstream 388042 2538990 ~ 2539204 (+)
G268641 NA non-coding downstream 394449 2545397 ~ 2545668 (+)
G267577 NA other upstream 1068093 1082153 ~ 1082655 (+)
G267432 NA other upstream 1367869 782283 ~ 782879 (+)
G266932 NA other upstream 2106082 43038 ~ 44666 (+)
G268525 NA other downstream 88211 2239159 ~ 2239998 (+)
G268805 NA other downstream 457959 2608907 ~ 2638205 (+)
G269181 NA other downstream 1308009 3458957 ~ 3462928 (+)
G269225 NA other downstream 1401856 3552804 ~ 3553214 (+)

Expression


Co-expression Network