G268751



Basic Information


Item Value
gene id G268751
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000065
NCBI id null
chromosome length 4956624
location 2538108 ~ 2538324 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU304936
GCCAACTATTCTTTCGAGTAATTAATCTACATTCCAATTACAAAAAAAGTACATCAACGAAAATTATTTGTGGCTTTGTGTGTCCAATTCCATTGGCAATGACTCAAATATCTGTTTTCCATTTATGCATCAAGAAATATAGATCAAACAGCAGTAGATGTGAGAGAAAACAAGGCTTTTCATCCGCTCTCCAGGATTGCTGGTGGGTTTCTCCCGC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU304936 True 217 lncRNA 0.37 1 2538108 2538324
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000065_02358877_02366169 NA coding downstream 171939 2358853 ~ 2366169 (-)
CI01000065_02288372_02357728 GRIK3 coding downstream 180380 2288372 ~ 2357728 (-)
CI01000065_01982908_01987337 NA coding downstream 550620 1982403 ~ 1987488 (-)
CI01000065_01955024_01969974 NA coding downstream 567885 1952778 ~ 1970223 (-)
CI01000065_01911879_01931555 HACE1, HACE1.L coding downstream 606553 1911512 ~ 1931555 (-)
CI01000065_02679973_02700843 NA coding upstream 141515 2679839 ~ 2701444 (-)
CI01000065_02820772_02829132 NA coding upstream 281388 2819712 ~ 2829132 (-)
CI01000065_02940142_02940429 NA coding upstream 401730 2940054 ~ 2940813 (-)
CI01000065_02979795_02989709 BVES coding upstream 439519 2977843 ~ 2989763 (-)
CI01000065_02992054_02993108 POPDC3 coding upstream 453491 2991815 ~ 2993167 (-)
G268657 NA non-coding downstream 117175 2399327 ~ 2420933 (-)
G268701 NA non-coding downstream 277300 2260492 ~ 2260808 (-)
G268687 NA non-coding downstream 294683 2241130 ~ 2243425 (-)
G268759 NA non-coding upstream 7782 2546106 ~ 2546464 (-)
G268790 NA non-coding upstream 54209 2592533 ~ 2592919 (-)
G268795 NA non-coding upstream 60267 2598591 ~ 2598992 (-)
G268836 NA non-coding upstream 137781 2676105 ~ 2676427 (-)
G268860 NA non-coding upstream 165688 2704012 ~ 2704359 (-)
CI01000065_00782736_00793467 NT5C3A, NT5C3 other downstream 1754447 782697 ~ 793467 (-)
CI01000065_00622545_00624625 NA other downstream 1913451 622123 ~ 624657 (-)
CI01000065_00563411_00579174 MBPB, MBP other downstream 1958081 562848 ~ 580083 (-)
CI01000065_00050903_00055774 NA other downstream 2483721 50386 ~ 55774 (-)
G267024 NA other downstream 2492021 43039 ~ 46087 (-)
G269348 NA other upstream 770119 3304357 ~ 3312480 (-)
G269679 NA other upstream 1235556 3773880 ~ 3774294 (-)
CI01000065_03794501_03806693 VEGFAA, VEGFA other upstream 1254799 3793123 ~ 3806693 (-)

Expression


G268751 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

G268751 Expression in each Bioproject

Bar chart with 4 bars.
G268751 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network