G268638


Basic Information

Item Value
gene id G268638
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000065
NCBI id null
chromosome length 4956624
location 2538990 ~ 2539204 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU304798
ATAATTTTGTGTATATACATTTTTATAAAATGATTTCAAAATTTGGTATATTGTGAATTTACTAATTATATATGGAAAATTCTTTATCCACAAATGTAAATGGGGAGGGAAAAAGCCTAATTTTGCTCATTTTAAAATAGAAATAGGTCACTACTTGTATACATTAAAAGAAACAAGAAATAACAAAGCCAAAAAAACTGTAAATTATTTTAAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU304798 True 215 lncRNA 0.22 1 2538990 2539204

Neighbor

gene id symbol gene type direction distance location
CI01000065_02442834_02444552 NA coding upstream 93039 2441659 ~ 2445951 (+)
CI01000065_02222213_02282352 NA coding upstream 256558 2222029 ~ 2282432 (+)
CI01000065_01938179_01949512 NA coding upstream 588239 1938085 ~ 1950751 (+)
CI01000065_01867964_01868983 NA coding upstream 669177 1867788 ~ 1869813 (+)
CI01000065_01452148_01608735 GRIK2 coding upstream 930255 1452148 ~ 1608735 (+)
CI01000065_02562189_02562709 NA coding downstream 22985 2562189 ~ 2562738 (+)
CI01000065_02714893_02755256 NA coding downstream 174237 2713441 ~ 2755370 (+)
CI01000065_02770419_02775297 NA coding downstream 230845 2770049 ~ 2776165 (+)
CI01000065_02783579_02788578 NA coding downstream 244111 2783315 ~ 2788866 (+)
CI01000065_02806198_02813320 NA coding downstream 266994 2806198 ~ 2813722 (+)
G268635 NA non-coding upstream 1615 2537144 ~ 2537375 (+)
G268603 NA non-coding upstream 8685 2464783 ~ 2530305 (+)
G268576 NA non-coding upstream 141283 2397197 ~ 2397707 (+)
G268502 NA non-coding upstream 388042 2150748 ~ 2150948 (+)
G268472 NA non-coding upstream 447880 2090845 ~ 2091110 (+)
G268641 NA non-coding downstream 6193 2545397 ~ 2545668 (+)
G268647 NA non-coding downstream 24207 2563411 ~ 2563637 (+)
G268786 NA non-coding downstream 48223 2587427 ~ 2587726 (+)
G268787 NA non-coding downstream 48819 2588023 ~ 2588312 (+)
G268789 NA non-coding downstream 53329 2592533 ~ 2592911 (+)
G268525 NA other upstream 298992 2239159 ~ 2239998 (+)
G267577 NA other upstream 1456335 1082153 ~ 1082655 (+)
G267432 NA other upstream 1756111 782283 ~ 782879 (+)
G266932 NA other upstream 2494324 43038 ~ 44666 (+)
G268805 NA other downstream 69703 2608907 ~ 2638205 (+)
G269181 NA other downstream 919753 3458957 ~ 3462928 (+)
G269225 NA other downstream 1013600 3552804 ~ 3553214 (+)

Expression


Co-expression Network