G268790


Basic Information

Item Value
gene id G268790
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000065
NCBI id null
chromosome length 4956624
location 2592533 ~ 2592919 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU304976
GGAACTAACAACAGAGGCTTCCAGAGATCGCTAACCATGGCTATAACATGCAGATAAACACTTTTGAAGATAATAAATACATGATTGCGACGATGTATACACGTATTGCCTCAGAATTTGCCTCTGAATATTGCTCGCTCCGTGGGCGTGGCCGCATTAGCGGATAATGAGCTGACTCACGGACATCTGACATGTGTCTCTTTTCATTCAAATTACATAAACAGAAAATTTTTGTTTTTGATTTGACTTACACGATTTAAAACCTGACATTTCAACATCTCTTTAGACATAAGTCTCATTTTTTTGTGATTAGTATTCACTAAGTTACAGTTCATTTATAGTTCTGAGAACTATCAGATTGGACTTTGTTCAGAGGGAGACGAAAGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU304976 True 387 lncRNA 0.37 1 2592533 2592919

Neighbor

gene id symbol gene type direction distance location
CI01000065_02358877_02366169 NA coding downstream 226364 2358853 ~ 2366169 (-)
CI01000065_02288372_02357728 GRIK3 coding downstream 234805 2288372 ~ 2357728 (-)
CI01000065_01982908_01987337 NA coding downstream 605045 1982403 ~ 1987488 (-)
CI01000065_01955024_01969974 NA coding downstream 622310 1952778 ~ 1970223 (-)
CI01000065_01911879_01931555 HACE1, HACE1.L coding downstream 660978 1911512 ~ 1931555 (-)
CI01000065_02679973_02700843 NA coding upstream 86920 2679839 ~ 2701444 (-)
CI01000065_02820772_02829132 NA coding upstream 226793 2819712 ~ 2829132 (-)
CI01000065_02940142_02940429 NA coding upstream 347135 2940054 ~ 2940813 (-)
CI01000065_02979795_02989709 BVES coding upstream 384924 2977843 ~ 2989763 (-)
CI01000065_02992054_02993108 POPDC3 coding upstream 398896 2991815 ~ 2993167 (-)
G268759 NA non-coding downstream 46069 2546106 ~ 2546464 (-)
G268751 NA non-coding downstream 54209 2538108 ~ 2538324 (-)
G268657 NA non-coding downstream 171600 2399327 ~ 2420933 (-)
G268795 NA non-coding upstream 5672 2598591 ~ 2598992 (-)
G268836 NA non-coding upstream 83186 2676105 ~ 2676427 (-)
G268860 NA non-coding upstream 111093 2704012 ~ 2704359 (-)
G268923 NA non-coding upstream 198451 2791370 ~ 2791594 (-)
G269262 NA non-coding upstream 262745 2855664 ~ 2856587 (-)
CI01000065_00782736_00793467 NT5C3A, NT5C3 other downstream 1808872 782697 ~ 793467 (-)
CI01000065_00622545_00624625 NA other downstream 1967876 622123 ~ 624657 (-)
CI01000065_00563411_00579174 MBPB, MBP other downstream 2012506 562848 ~ 580083 (-)
CI01000065_00050903_00055774 NA other downstream 2538146 50386 ~ 55774 (-)
G267024 NA other downstream 2546446 43039 ~ 46087 (-)
G269348 NA other upstream 715524 3304357 ~ 3312480 (-)
G269679 NA other upstream 1180961 3773880 ~ 3774294 (-)
CI01000065_03794501_03806693 VEGFAA, VEGFA other upstream 1200204 3793123 ~ 3806693 (-)

Expression


Co-expression Network