G268859


Basic Information

Item Value
gene id G268859
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000065
NCBI id null
chromosome length 4956624
location 2703400 ~ 2703611 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU305048
GGTTGTACCTAGGATAGCTAAGTCCTCTAAAGGAGGGAGAGCGTTTTCACATTTGGCTCCTAAACTCTGGAATAGCCTTCCTGATAATGTTCGGGGCTCAGACTCGCTCACCCAGTTTAAATCTAGATTAAAGACACATCTCTTTAGCCAAGCATTCACATAATCCATCTCATATCAGATCAAGAGTACATCAGTTTCAGTTTGGATCCAGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU305048 True 212 lncRNA 0.43 1 2703400 2703611

Neighbor

gene id symbol gene type direction distance location
CI01000065_02562189_02562709 NA coding upstream 140662 2562189 ~ 2562738 (+)
CI01000065_02442834_02444552 NA coding upstream 257449 2441659 ~ 2445951 (+)
CI01000065_02222213_02282352 NA coding upstream 420968 2222029 ~ 2282432 (+)
CI01000065_01938179_01949512 NA coding upstream 752649 1938085 ~ 1950751 (+)
CI01000065_01867964_01868983 NA coding upstream 833587 1867788 ~ 1869813 (+)
CI01000065_02714893_02755256 NA coding downstream 9830 2713441 ~ 2755370 (+)
CI01000065_02770419_02775297 NA coding downstream 66438 2770049 ~ 2776165 (+)
CI01000065_02783579_02788578 NA coding downstream 79704 2783315 ~ 2788866 (+)
CI01000065_02806198_02813320 NA coding downstream 102587 2806198 ~ 2813722 (+)
CI01000065_02856492_02888060 INPP5B coding downstream 152881 2856492 ~ 2888455 (+)
G268796 NA non-coding upstream 103408 2599769 ~ 2599992 (+)
G268789 NA non-coding upstream 110489 2592533 ~ 2592911 (+)
G268787 NA non-coding upstream 115088 2588023 ~ 2588312 (+)
G268786 NA non-coding upstream 115674 2587427 ~ 2587726 (+)
G268647 NA non-coding upstream 139763 2563411 ~ 2563637 (+)
G268930 NA non-coding downstream 98033 2801644 ~ 2801857 (+)
G268965 NA non-coding downstream 235577 2939188 ~ 2940607 (+)
G268974 NA non-coding downstream 245591 2949202 ~ 2950412 (+)
G268996 NA non-coding downstream 293925 2997536 ~ 2999784 (+)
G268997 NA non-coding downstream 296732 3000343 ~ 3001750 (+)
G268805 NA other upstream 65195 2608907 ~ 2638205 (+)
G268525 NA other upstream 463402 2239159 ~ 2239998 (+)
G267577 NA other upstream 1620745 1082153 ~ 1082655 (+)
G267432 NA other upstream 1920521 782283 ~ 782879 (+)
G266932 NA other upstream 2658734 43038 ~ 44666 (+)
G269181 NA other downstream 755346 3458957 ~ 3462928 (+)
G269225 NA other downstream 849193 3552804 ~ 3553214 (+)

Expression


Co-expression Network