G269262


Basic Information

Item Value
gene id G269262
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000065
NCBI id null
chromosome length 4956624
location 2855664 ~ 2856587 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU305526
CCTTGTCCTGCTGCACCAGTCCGATCAGTTTGCTCTCTTTCACATCATTCAGCAGTGAAACACACTCCACAGCTATAGTGCAGTTTTCCCCTTTGGACAAAGTCTCTTGAATTGCCACGGACTGATCCATTATTCACAGCAAGTCCTCAGCCGATACTTCAAGCGTAAGACGTGTCATTCAAGATCGTTTTACATCGACAGACGTTTAAAGTGTGCCGGATAACGGTAGTGTTACTGTCTGTCTTCATGGTTTCCTCTGCAACTTCCCGTCCGAACCTCCCTTAACGCCACGCAGCACACTCGAGTTCATGATCACCACTCAAATCATCAGTTTATCACAGCATCTGTAATCGAAGAGTCTCGTCGGCAACGCTAATGGAAACACTTATGATTTTCCTCTTCTTTTACATATAACTTTTCTTCTGGCCGTCAGAGTCTGCAGAGAGACATCAAACTTAGCAGAATGATC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU305526 True 469 lncRNA 0.45 2 2855664 2856587

Neighbor

gene id symbol gene type direction distance location
CI01000065_02820772_02829132 NA coding downstream 26532 2819712 ~ 2829132 (-)
CI01000065_02679973_02700843 NA coding downstream 154220 2679839 ~ 2701444 (-)
CI01000065_02358877_02366169 NA coding downstream 489495 2358853 ~ 2366169 (-)
CI01000065_02288372_02357728 GRIK3 coding downstream 497936 2288372 ~ 2357728 (-)
CI01000065_01982908_01987337 NA coding downstream 868176 1982403 ~ 1987488 (-)
CI01000065_02940142_02940429 NA coding upstream 83467 2940054 ~ 2940813 (-)
CI01000065_02979795_02989709 BVES coding upstream 121256 2977843 ~ 2989763 (-)
CI01000065_02992054_02993108 POPDC3 coding upstream 135228 2991815 ~ 2993167 (-)
CI01000065_03015397_03024204 NA coding upstream 158265 3014852 ~ 3024204 (-)
CI01000065_03037531_03045960 SMPDL3B coding upstream 180774 3037361 ~ 3045960 (-)
G268923 NA non-coding downstream 64070 2791370 ~ 2791594 (-)
G268860 NA non-coding downstream 151305 2704012 ~ 2704359 (-)
G268836 NA non-coding downstream 179237 2676105 ~ 2676427 (-)
G268795 NA non-coding downstream 256672 2598591 ~ 2598992 (-)
G268790 NA non-coding downstream 262745 2592533 ~ 2592919 (-)
G269250 NA non-coding upstream 66558 2923145 ~ 2924417 (-)
G269252 NA non-coding upstream 67990 2924577 ~ 2929006 (-)
G269253 NA non-coding upstream 75563 2932150 ~ 2933546 (-)
G269302 NA non-coding upstream 81333 2937920 ~ 2938284 (-)
G269303 NA non-coding upstream 82121 2938708 ~ 2939167 (-)
CI01000065_00782736_00793467 NT5C3A, NT5C3 other downstream 2072003 782697 ~ 793467 (-)
CI01000065_00622545_00624625 NA other downstream 2231007 622123 ~ 624657 (-)
CI01000065_00563411_00579174 MBPB, MBP other downstream 2275637 562848 ~ 580083 (-)
CI01000065_00050903_00055774 NA other downstream 2801277 50386 ~ 55774 (-)
G267024 NA other downstream 2809577 43039 ~ 46087 (-)
G269348 NA other upstream 451856 3304357 ~ 3312480 (-)
G269679 NA other upstream 917293 3773880 ~ 3774294 (-)
CI01000065_03794501_03806693 VEGFAA, VEGFA other upstream 936536 3793123 ~ 3806693 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
tiger barb (Puntius tetrazona) G109819 NA non-coding NC_056714.1 CM032083.1 4818807 ~ 4819736 (-)