G269399


Basic Information

Item Value
gene id G269399
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000065
NCBI id null
chromosome length 4956624
location 3490572 ~ 3491380 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU305713
GTCACAGTTCCAAGACCAAGAAATGTTCCCGAGTCACTCACTGCAAGACAAGATATAACTTCATTTCCACAAGGCTTCGTGAGCAGCGGCAGGAAAGCGCGTCCGTCCCATTTGGTGATGTAGCATTGTGGGGGTTTTCGCTCCCGTTTGTGAGGGATTTGGATCGTGTAGAGTCTTAAAGCATCTTTCTGATCCTCTACTTTTGCAAACCTGCATGCCTTGTAGCGGTATGTCTTCTCAGTGATCTGAGGCATGCTTTCATGCCAACACAAACCCACGGCCAGCTGATCGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU305713 True 292 lncRNA 0.49 3 3490572 3491380

Neighbor

gene id symbol gene type direction distance location
CI01000065_03442791_03477709 DNAJC27, ADCY3A, ADCY3 coding downstream 12863 3442595 ~ 3477709 (-)
CI01000065_03413002_03434286 WDR26, WDR26.S coding downstream 56286 3412729 ~ 3434286 (-)
CI01000065_03385522_03396519 FEZ2 coding downstream 93491 3385522 ~ 3397081 (-)
CI01000065_03373810_03377138 NA coding downstream 113434 3372703 ~ 3377138 (-)
CI01000065_03369379_03371121 NA coding downstream 119131 3368919 ~ 3371441 (-)
CI01000065_03544613_03551034 NA coding upstream 53151 3544531 ~ 3551034 (-)
CI01000065_03589916_03598053 NA coding upstream 98391 3589771 ~ 3598146 (-)
CI01000065_03602063_03603667 NA coding upstream 109382 3600762 ~ 3605308 (-)
CI01000065_03648940_03692253 TGFB2 coding upstream 157023 3648403 ~ 3692368 (-)
CI01000065_03694059_03694764 NA coding upstream 202427 3693807 ~ 3694764 (-)
G269440 NA non-coding downstream 53182 3437138 ~ 3437390 (-)
G269436 NA non-coding downstream 93213 3397110 ~ 3397359 (-)
G269424 NA non-coding downstream 137669 3351600 ~ 3352903 (-)
G269348 NA non-coding downstream 185033 3304357 ~ 3312480 (-)
G269337 NA non-coding downstream 381017 3108288 ~ 3109555 (-)
G269446 NA non-coding upstream 4708 3496088 ~ 3496312 (-)
G269448 NA non-coding upstream 26356 3517736 ~ 3518149 (-)
G269461 NA non-coding upstream 60423 3551803 ~ 3552012 (-)
G269462 NA non-coding upstream 61509 3552889 ~ 3553113 (-)
G269463 NA non-coding upstream 62937 3554317 ~ 3554526 (-)
CI01000065_00782736_00793467 NT5C3A, NT5C3 other downstream 2706911 782697 ~ 793467 (-)
CI01000065_00622545_00624625 NA other downstream 2865915 622123 ~ 624657 (-)
CI01000065_00563411_00579174 MBPB, MBP other downstream 2910545 562848 ~ 580083 (-)
CI01000065_00050903_00055774 NA other downstream 3436185 50386 ~ 55774 (-)
G269679 NA other upstream 282500 3773880 ~ 3774294 (-)
CI01000065_03794501_03806693 VEGFAA, VEGFA other upstream 301743 3793123 ~ 3806693 (-)

Expression


Co-expression Network