G269223


Basic Information

Item Value
gene id G269223
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000065
NCBI id null
chromosome length 4956624
location 3551770 ~ 3551991 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU305474
GGACAGTATTAAATTTAATACTTAAATCATGACATAAAATTAACAGTTCAGATGGACCTGTAGGAAGATAACAATAATAAATGTATTAACATTAAAGGAATAGTTCACCCAAAAATGAAAATTCTCTCATCATTTACTCGCTCTCAAGTTGTTTTAAACCTGAATGAATTTCTTTCTTCTGCTGAACACAAAATAAGATATTTTGAAAAATGTGGGTTGCTG

Function

NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU305474 True 222 lncRNA 0.29 1 3551770 3551991

Neighbor

gene id symbol gene type direction distance location
CI01000065_03486630_03494354 NA coding upstream 56030 3486567 ~ 3495740 (+)
CI01000065_03398558_03399971 CNIH4 coding upstream 151345 3398558 ~ 3400425 (+)
CI01000065_03344678_03368295 NA coding upstream 183298 3344331 ~ 3368472 (+)
CI01000065_03304326_03307505 NA coding upstream 244213 3303725 ~ 3307557 (+)
CI01000065_03244494_03285831 NA coding upstream 265939 3244494 ~ 3285831 (+)
CI01000065_03692428_03692874 NA coding downstream 140437 3692428 ~ 3693420 (+)
CI01000065_03709249_03716992 NA coding downstream 157153 3709144 ~ 3717908 (+)
CI01000065_03815841_03816140 NA coding downstream 260867 3812858 ~ 3816590 (+)
CI01000065_03980525_03983765 NA coding downstream 428534 3980525 ~ 3984923 (+)
CI01000065_03986974_04006773 CYP4T8 coding downstream 434983 3986974 ~ 4007259 (+)
G269218 NA non-coding upstream 9198 3542103 ~ 3542572 (+)
G269205 NA non-coding upstream 35229 3516294 ~ 3516541 (+)
G269181 NA non-coding upstream 89951 3458957 ~ 3462928 (+)
G269167 NA non-coding upstream 113231 3437972 ~ 3438539 (+)
G269033 NA non-coding upstream 438856 3111847 ~ 3112914 (+)
G269225 NA non-coding downstream 842 3552804 ~ 3553214 (+)
G269232 NA non-coding downstream 15340 3567331 ~ 3567533 (+)
G269238 NA non-coding downstream 28065 3580056 ~ 3580380 (+)
G269240 NA non-coding downstream 30942 3582933 ~ 3583163 (+)
G269505 NA non-coding downstream 78693 3630684 ~ 3631579 (+)
G268805 NA other upstream 913565 2608907 ~ 2638205 (+)
G268525 NA other upstream 1311772 2239159 ~ 2239998 (+)
G267577 NA other upstream 2469115 1082153 ~ 1082655 (+)
G267432 NA other upstream 2768891 782283 ~ 782879 (+)

Expression


Co-expression Network