G269463


Basic Information

Item Value
gene id G269463
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000065
NCBI id null
chromosome length 4956624
location 3554317 ~ 3554526 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU305789
TGATGCTTTGGGCAATGTTCTGCTGGGAAACCTTGGGTCCTGCCATCCATGTGGATGTTACTTTGACACGTACCACCTACCTAAGCATTGTTGCAGACCATGTACACCCTTTCATGGAAACGGTATTCCCTGGTGGCTGTGGTCTCTTTCAGCAGGATAATGCGCCCTGCCACAAAGCAAAAATGGTTCAGGAATGGTTTGAAGAGCACA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU305789 True 210 lncRNA 0.49 1 3554317 3554526

Neighbor

gene id symbol gene type direction distance location
CI01000065_03544613_03551034 NA coding downstream 3283 3544531 ~ 3551034 (-)
CI01000065_03442791_03477709 DNAJC27, ADCY3A, ADCY3 coding downstream 76608 3442595 ~ 3477709 (-)
CI01000065_03413002_03434286 WDR26, WDR26.S coding downstream 120031 3412729 ~ 3434286 (-)
CI01000065_03385522_03396519 FEZ2 coding downstream 157236 3385522 ~ 3397081 (-)
CI01000065_03373810_03377138 NA coding downstream 177179 3372703 ~ 3377138 (-)
CI01000065_03589916_03598053 NA coding upstream 35245 3589771 ~ 3598146 (-)
CI01000065_03602063_03603667 NA coding upstream 46236 3600762 ~ 3605308 (-)
CI01000065_03648940_03692253 TGFB2 coding upstream 93877 3648403 ~ 3692368 (-)
CI01000065_03694059_03694764 NA coding upstream 139281 3693807 ~ 3694764 (-)
CI01000065_03701147_03703052 RRP15 coding upstream 146605 3701131 ~ 3703052 (-)
G269462 NA non-coding downstream 1204 3552889 ~ 3553113 (-)
G269461 NA non-coding downstream 2305 3551803 ~ 3552012 (-)
G269448 NA non-coding downstream 36168 3517736 ~ 3518149 (-)
G269446 NA non-coding downstream 58005 3496088 ~ 3496312 (-)
G269399 NA non-coding downstream 62937 3490572 ~ 3491380 (-)
G269470 NA non-coding upstream 22963 3577489 ~ 3577738 (-)
G269629 NA non-coding upstream 85594 3640120 ~ 3640411 (-)
G269630 NA non-coding upstream 86227 3640753 ~ 3640997 (-)
G269645 NA non-coding upstream 160321 3714847 ~ 3715306 (-)
G269647 NA non-coding upstream 163957 3718483 ~ 3718687 (-)
G269348 NA other downstream 241837 3304357 ~ 3312480 (-)
CI01000065_00782736_00793467 NT5C3A, NT5C3 other downstream 2770656 782697 ~ 793467 (-)
CI01000065_00622545_00624625 NA other downstream 2929660 622123 ~ 624657 (-)
CI01000065_00563411_00579174 MBPB, MBP other downstream 2974290 562848 ~ 580083 (-)
CI01000065_00050903_00055774 NA other downstream 3499930 50386 ~ 55774 (-)
G269679 NA other upstream 219354 3773880 ~ 3774294 (-)
CI01000065_03794501_03806693 VEGFAA, VEGFA other upstream 238597 3793123 ~ 3806693 (-)

Expression


Co-expression Network