G269605



Basic Information


Item Value
gene id G269605
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000065
NCBI id null
chromosome length 4956624
location 3855999 ~ 3856276 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU305942
ACATTATGGAAGTGTACTTTTTTTCACACATCCGAGAGTCGAAACAAGTAAAATGCACCAAAAGAGCTCTTTACCTCCGCCCACTCCCATGAAGCAATACAAATGACATAATCGAGTTGGTCTACCTATGCTCTCAAAATACATAAAAATTTGAATATAAATGCATATTTTGCAATAAACTTAAAATATATTGTTTTTATATATACAATCAACATTTTAAAATTAGTAGTTTTTAGTGCTGTCAAATTGATTAATCACCATTAATCACTAGTAGTGAC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU305942 True 278 lncRNA 0.30 1 3855999 3856276

Neighbor


gene id symbol gene type direction distance location
CI01000065_03815841_03816140 NA coding upstream 39409 3812858 ~ 3816590 (+)
CI01000065_03709249_03716992 NA coding upstream 138091 3709144 ~ 3717908 (+)
CI01000065_03692428_03692874 NA coding upstream 162579 3692428 ~ 3693420 (+)
CI01000065_03486630_03494354 NA coding upstream 360259 3486567 ~ 3495740 (+)
CI01000065_03398558_03399971 CNIH4 coding upstream 455574 3398558 ~ 3400425 (+)
CI01000065_03980525_03983765 NA coding downstream 124249 3980525 ~ 3984923 (+)
CI01000065_03986974_04006773 CYP4T8 coding downstream 130698 3986974 ~ 4007259 (+)
CI01000065_04008274_04010105 NA coding downstream 151998 4008274 ~ 4010194 (+)
CI01000065_04044257_04051771 THEMIS2 coding downstream 187981 4044257 ~ 4052283 (+)
CI01000065_04081314_04103789 NA coding downstream 225038 4081314 ~ 4103961 (+)
G269592 NA non-coding upstream 31188 3824592 ~ 3824811 (+)
G269567 NA non-coding upstream 52325 3793245 ~ 3803674 (+)
G269569 NA non-coding upstream 53356 3798157 ~ 3802643 (+)
G269587 NA non-coding upstream 68565 3787197 ~ 3787434 (+)
G269586 NA non-coding upstream 69072 3786638 ~ 3786927 (+)
G269607 NA non-coding downstream 3247 3859523 ~ 3859979 (+)
G269733 NA non-coding downstream 47103 3903379 ~ 3903627 (+)
G269734 NA non-coding downstream 47815 3904091 ~ 3904490 (+)
G269746 NA non-coding downstream 53401 3909677 ~ 3909913 (+)
G269790 NA non-coding downstream 86077 3942353 ~ 3942678 (+)
G269225 NA other upstream 302875 3552804 ~ 3553214 (+)
G269181 NA other upstream 393071 3458957 ~ 3462928 (+)
G268805 NA other upstream 1217794 2608907 ~ 2638205 (+)
G268525 NA other upstream 1616001 2239159 ~ 2239998 (+)
G267577 NA other upstream 2773344 1082153 ~ 1082655 (+)

Expression



Co-expression Network