G270311


Basic Information

Item Value
gene id G270311
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000065
NCBI id null
chromosome length 4956624
location 4483290 ~ 4483633 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU306745
CTTTTATTCACATATAAACATTGATAACTCACACATATCAGTTATGGTAAATGGAAGCTCAAGTATGTTTGCTTGACGTTCGAGAACCAATGTATTCTCATGTGTTACGCAGCACGTTTGAGCTTCAGCAAGAACCAATGAGGTTCATTCTTGTGTTACGCATCACGTTTGAGCTTTCACAAGAGGTTTGTTCTCGCGCGTCAAGCAGGTTCGATTGATCTTCTGTTCATGTTTGCTGATGAATGTTTATATGTGAATAAAATCCTAAATTCAATCTGTTCATCATATAAAGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU306745 True 293 lncRNA 0.37 2 4483290 4483633

Neighbor

gene id symbol gene type direction distance location
CI01000065_04470763_04478735 NA coding downstream 4182 4469999 ~ 4479108 (-)
CI01000065_04318691_04330504 NA coding downstream 152508 4318435 ~ 4330782 (-)
CI01000065_04178828_04180116 NA coding downstream 303174 4177958 ~ 4180116 (-)
CI01000065_04070422_04072088 NA coding downstream 411202 4070204 ~ 4072088 (-)
CI01000065_04027497_04039742 PPP1R8B, PPP1R8 coding downstream 443548 4026510 ~ 4039742 (-)
CI01000065_04484009_04501087 TTK coding upstream 376 4484009 ~ 4501087 (-)
CI01000065_04507862_04513517 DCTN3 coding upstream 24229 4507862 ~ 4513517 (-)
CI01000065_04657955_04662886 NA coding upstream 173976 4657609 ~ 4663107 (-)
CI01000065_04705952_04710430 NA coding upstream 222266 4705899 ~ 4710588 (-)
CI01000065_04876578_04886460 NA coding upstream 392146 4875779 ~ 4887207 (-)
G270242 NA non-coding downstream 110076 4372764 ~ 4373214 (-)
G270240 NA non-coding downstream 112148 4370808 ~ 4371142 (-)
G270288 NA non-coding downstream 146826 4336207 ~ 4336464 (-)
G270287 NA non-coding downstream 147107 4335857 ~ 4336183 (-)
G270268 NA non-coding downstream 169253 4298982 ~ 4314037 (-)
G270345 NA non-coding upstream 91806 4575439 ~ 4575701 (-)
G270404 NA non-coding upstream 170062 4653695 ~ 4655279 (-)
G270442 NA non-coding upstream 280449 4764082 ~ 4764604 (-)
G270444 NA non-coding upstream 284329 4767962 ~ 4768239 (-)
CI01000065_03794501_03806693 VEGFAA, VEGFA other downstream 673047 3793123 ~ 3806693 (-)
G269679 NA other downstream 708996 3773880 ~ 3774294 (-)
G269348 NA other downstream 1170810 3304357 ~ 3312480 (-)
CI01000065_00782736_00793467 NT5C3A, NT5C3 other downstream 3699629 782697 ~ 793467 (-)
CI01000065_00622545_00624625 NA other downstream 3858633 622123 ~ 624657 (-)

Expression


Co-expression Network